Dataset for CDS BCL-2-like of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6PHG5_BCL2A1-      atgacagactgtg-----------------aatttggatatatt------
A0A2K6PHG5_BCL2A1-      atgacagactgtg-----------------aatttggatatatt------
A0A2K6R5T5_BCL2L10      atggctgaccc---------gttgcgcg---agcgcac------------
A0A2K6PPL1_MCL1-02      atgtttggcttca----aaagaaacgcggtaatcggac------------
A0A2K6PPL1_MCL1-03      atgtttggcttca----aaagaaacgcggtaatcggac------------
A0A2K6PPL1_MCL1-01      atgtttggcttca----aaagaaacgcggtaatcggac------------
A0A2K6R2I6_BCL2-02      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K6R2I6_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K6QFA2_BCL2L1-      at------------------gtctcagagcaaccgggagctggtggttga
A0A2K6QFA2_BCL2L1-      at------------------gtctcagagcaaccgggagctggtggttga
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K6RW46_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K6RW46_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
                                                                          

A0A2K6PHG5_BCL2A1-      ----------tacaggctagctca---ggactatttgc------------
A0A2K6PHG5_BCL2A1-      ----------tacaggctagctca---ggactatttgc------------
A0A2K6R5T5_BCL2L10      ------------cgagcggttgct---ggccgactatctgggg-------
A0A2K6PPL1_MCL1-02      ------------tcaacctctactgtgggggggccggcttggg-------
A0A2K6PPL1_MCL1-03      ------------tcaacctctactgtgggggggccggcttggg-------
A0A2K6PPL1_MCL1-01      ------------tcaacctctactgtgggggggccggcttggg-------
A0A2K6R2I6_BCL2-02      gtacatccactataagctgtcgcagaggggctac-gagtggga-------
A0A2K6R2I6_BCL2-01      gtacatccactataagctgtcgcagaggggctac-gagtggga-------
A0A2K6QFA2_BCL2L1-      ctttctctcctacaagctttcccagaaaggatac-agctggagtcagttt
A0A2K6QFA2_BCL2L1-      ctttctctcctacaagctttcccagaaaggatac-agctggagtcagttt
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      ctttttaggttataagctgaggcagaagggttat-gtc------------
A0A2K6RW46_BCL2L2-      ctttttaggttataagctgaggcagaagggttat-gtc------------
A0A2K6RW46_BCL2L2-      ctttttaggttataagctgaggcagaagggttat-gtc------------
                                                                          

A0A2K6PHG5_BCL2A1-      -----agtacgtcctgcagataccacaacctggatcgggtccaagcaaaa
A0A2K6PHG5_BCL2A1-      -----agtacgtcctgcagataccacaacctggatcgggtccaagcaaaa
A0A2K6R5T5_BCL2L10      -----tgctgcgcccgggaacccggcacccccgagccgaggccgtccacg
A0A2K6PPL1_MCL1-02      -----ggccggcagcggcggcgccacccctccgggagggcggcttttggc
A0A2K6PPL1_MCL1-03      -----ggccggcagcggcggcgccacccctccgggagggcggctttt---
A0A2K6PPL1_MCL1-01      -----ggccggcagcggcggcgccacccctccgggagggcggcttttggc
A0A2K6R2I6_BCL2-02      -----tgcgggagatgtgggcgccgcgacccctggggccgcccc--cgca
A0A2K6R2I6_BCL2-01      -----tgcgggagatgtgggcgccgcgacccctggggccgcccc--cgca
A0A2K6QFA2_BCL2L1-      agtgatgtggaagagaacaggactgaggccccagaagggactgaatcgga
A0A2K6QFA2_BCL2L1-      agtgatgtggaagagaacaggactgaggccccagaagggactgaatcgga
A0A2K6QFA2_BCL2L1-      ----atgtggaagagaacaggactgaggccccagaagggactgaatcgga
A0A2K6RW46_BCL2L2-      -----tgtgga----------gct--ggccctggggagggccca---gca
A0A2K6RW46_BCL2L2-      -----tgtgga----------gct--ggccctggggagggccca---gca
A0A2K6RW46_BCL2L2-      -----tgtgga----------gct--ggccctggggagggccca---gca
                              *               *     *                     

A0A2K6PHG5_BCL2A1-      cgt-----------------------------------------------
A0A2K6PHG5_BCL2A1-      cgt-----------------------------------------------
A0A2K6R5T5_BCL2L10      cccgaggccgccgtgctgcgctccgcggcggccagg--------------
A0A2K6PPL1_MCL1-02      tacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      tacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
A0A2K6R2I6_BCL2-02      ccgggcatc-----------------------------------------
A0A2K6R2I6_BCL2-01      ccgggcatc-----------------------------------------
A0A2K6QFA2_BCL2L1-      gatggagac-----------------------------------------
A0A2K6QFA2_BCL2L1-      gatggagac-----------------------------------------
A0A2K6QFA2_BCL2L1-      gatggagac-----------------------------------------
A0A2K6RW46_BCL2L2-      gct---gac-----------------------------------------
A0A2K6RW46_BCL2L2-      gct---gac-----------------------------------------
A0A2K6RW46_BCL2L2-      gct---gac-----------------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      ----------ccagagtgctacaaaaggttgca---------ttctcagt
A0A2K6PHG5_BCL2A1-      ----------ccagagtgctacaaaaggttgca---------ttctcagt
A0A2K6R5T5_BCL2L10      ----------ttacggcagctccaccg---gtccttcttctctgcctacc
A0A2K6PPL1_MCL1-02      gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacg
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacg
A0A2K6R2I6_BCL2-02      ----------ttctcctcccagcccgggcacacgccccatcccgccgcgt
A0A2K6R2I6_BCL2-01      ----------ttctcctcccagcccgggcacacgccccatcccgccgcgt
A0A2K6QFA2_BCL2L1-      ----------ccccagtgccatcaatggcaacc--------------cat
A0A2K6QFA2_BCL2L1-      ----------ccccagtgccatcaatggcaacc--------------cat
A0A2K6QFA2_BCL2L1-      ----------ccccagtgccatcaatggcaacc--------------cat
A0A2K6RW46_BCL2L2-      ----------ccgctgcac---------caagc--------------cat
A0A2K6RW46_BCL2L2-      ----------ccgctgcac---------caagc--------------cat
A0A2K6RW46_BCL2L2-      ----------ccgctgcac---------caagc--------------cat
                                                                          

A0A2K6PHG5_BCL2A1-      ccagaaagaagtggaaaagaatct--------------------------
A0A2K6PHG5_BCL2A1-      ccagaaagaagtggaaaagaatct--------------------------
A0A2K6R5T5_BCL2L10      tcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggcc
A0A2K6PPL1_MCL1-02      ccagacgcccggagggtcgcgc--------ggccgccgcccattggcgcc
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      ccagacgcccggagggtcgcgc--------ggccgccgcccattggcgcc
A0A2K6R2I6_BCL2-02      cccgggacccggtcgccaggacctcgccgctgccgaccccggctgccccc
A0A2K6R2I6_BCL2-01      cccgggacccggtcgccaggacctcgccgctgccgaccccggctgccccc
A0A2K6QFA2_BCL2L1-      cctggcacctggtggacagccccgcggtgaatggagccactggccacagc
A0A2K6QFA2_BCL2L1-      cctggcacctggtggacagccccgcggtgaatggagccactggccacagc
A0A2K6QFA2_BCL2L1-      cct-----------------------------------------------
A0A2K6RW46_BCL2L2-      gcgggca-------------------------------------------
A0A2K6RW46_BCL2L2-      gcgggca-------------------------------------------
A0A2K6RW46_BCL2L2-      gcgggca-------------------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      gtgctctccgacagcccc-ggccccacctggggcagggtggtgtcgctgg
A0A2K6PPL1_MCL1-02      gaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcc
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      gaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcc
A0A2K6R2I6_BCL2-02      gccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacct
A0A2K6R2I6_BCL2-01      gccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacct
A0A2K6QFA2_BCL2L1-      agcagtttggatgcccgggaggtgatccccatggca---gcagtaaagca
A0A2K6QFA2_BCL2L1-      agcagtttggatgcccgggaggtgatccccatggca---gcagtaaagca
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      tgaccttcgcggggacgctgctggagagag---------agccgctggtg
A0A2K6PPL1_MCL1-02      cacccgccgcgcggcgcctcttgaggagatggaagccccggccgccgacg
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      cacccgccgcgcggcgcctcttgaggagatggaagccccggccgccgacg
A0A2K6R2I6_BCL2-02      gaccctccgccaggcc----------------------------------
A0A2K6R2I6_BCL2-01      gaccctccgccaggcc----------------------------------
A0A2K6QFA2_BCL2L1-      agcgctgagggaggca----------------------------------
A0A2K6QFA2_BCL2L1-      agcgctgagggaggca----------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      -------------gct----------------------------------
A0A2K6RW46_BCL2L2-      -------------gct----------------------------------
A0A2K6RW46_BCL2L2-      -------------gct----------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      acagcctggtggaagaagcggagct-------------------------
A0A2K6PPL1_MCL1-02      ccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctc
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      ccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctc
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      ----------------tccagccgcggctg--------------------
A0A2K6PPL1_MCL1-02      gggaagcggccggctgtcctgcccctgctggagttggtcggggaatctgg
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      gggaagcggccggctgtcctgcccctgctggagttggtcggggaatctgg
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      -------------------------------------------------a
A0A2K6PPL1_MCL1-02      taatagctccagtacggatgggtcactaccctcgacgccgccgccagcag
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      taatagctccagtacggatgggtcactaccctcgacgccgccgccagcag
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      --------gaagccatgcttggacaa------------------------
A0A2K6PHG5_BCL2A1-      --------gaagccatgcttggacaa------------------------
A0A2K6R5T5_BCL2L10      aggagcaggagggcgaggtcgcccgg------------------------
A0A2K6PPL1_MCL1-02      aggaggaggaggacgagttgtaccggcagtcactggaaattatctctcgg
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      aggaggaggaggacgagttgtaccggcagtcactggaaattatctctcgg
A0A2K6R2I6_BCL2-02      --------ggtgacgacttctcccgc------------------------
A0A2K6R2I6_BCL2-01      --------ggtgacgacttctcccgc------------------------
A0A2K6QFA2_BCL2L1-      --------ggcgacgagtttgaactg------------------------
A0A2K6QFA2_BCL2L1-      --------ggcgacgagtttgaactg------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------ggagatgagttcgagacc------------------------
A0A2K6RW46_BCL2L2-      --------ggagatgagttcgagacc------------------------
A0A2K6RW46_BCL2L2-      --------ggagatgagttcgagacc------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      --------------tgttaatgttgc------------------------
A0A2K6PHG5_BCL2A1-      --------------tgttaatgttgc------------------------
A0A2K6R5T5_BCL2L10      --------------gactgccagcgcctggtggccttgctgagctcgcgg
A0A2K6PPL1_MCL1-02      taccttcgggagcaggccaccggcgccaaggacacaaagccaatgggcag
A0A2K6PPL1_MCL1-03      --------------ggccaccggcgccaaggacacaaagccaatgggcag
A0A2K6PPL1_MCL1-01      taccttcgggagcaggccaccggcgccaaggacacaaagccaatgggcag
A0A2K6R2I6_BCL2-02      --------------cgctaccgccgc-----gacttcgccgagatgtcca
A0A2K6R2I6_BCL2-01      --------------cgctaccgccgc-----gacttcgccgagatgtcca
A0A2K6QFA2_BCL2L1-      --------------cggtaccggcgg-----gcgttcagtgacctgacat
A0A2K6QFA2_BCL2L1-      --------------cggtaccggcgg-----gcgttcagtgacctgacat
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------cgcttccggcgc-----accttctctgatctggcgg
A0A2K6RW46_BCL2L2-      --------------cgcttccggcgc-----accttctctgatctggcgg
A0A2K6RW46_BCL2L2-      --------------cgcttccggcgc-----accttctctgatctggcgg
                                                                          

A0A2K6PHG5_BCL2A1-      -------------atccatagacactgccagaacactattcaatcaagtg
A0A2K6PHG5_BCL2A1-      -------------atccatagacactgccagaacactattcaatcaagtg
A0A2K6R5T5_BCL2L10      ctcacgggg---cagcaccgcgcctggcttcagg---ctcagggcggctg
A0A2K6PPL1_MCL1-02      gtctggggc---caccagcaggaa-ggctctggagaccttacgacgggtg
A0A2K6PPL1_MCL1-03      gtctggggc---caccagcaggaa-ggctctggagaccttacgacgggtg
A0A2K6PPL1_MCL1-01      gtctggggc---caccagcaggaa-ggctctggagaccttacgacgggtg
A0A2K6R2I6_BCL2-02      gccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtg
A0A2K6R2I6_BCL2-01      gccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtg
A0A2K6QFA2_BCL2L1-      cccagctccacatcaccccagggacagcatatcagagctttgaacaggta
A0A2K6QFA2_BCL2L1-      cccagctccacatcaccccagggacagcatatcagagctttgaacaggta
A0A2K6QFA2_BCL2L1-      --------------------gggacagcatatcagagctttgaacaggta
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
A0A2K6RW46_BCL2L2-      ctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtc
                                                  **          *         * 

A0A2K6PHG5_BCL2A1-      atgga--------aaaggagtttgaagatggcat----------------
A0A2K6PHG5_BCL2A1-      atgga--------aaaggagtttgaagatggcat----------------
A0A2K6R5T5_BCL2L10      ggtga--gcacgcggcg-gacaccgggacg--------------------
A0A2K6PPL1_MCL1-02      ggggatggcgtgcagcgcaaccacgagacggctttccaa-----------
A0A2K6PPL1_MCL1-03      ggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcg
A0A2K6PPL1_MCL1-01      ggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcg
A0A2K6R2I6_BCL2-02      gtgga--------ggagctcttcagggacggggt----------------
A0A2K6R2I6_BCL2-01      gtgga--------ggagctcttcagggacggggt----------------
A0A2K6QFA2_BCL2L1-      gtgaa--------tgaactcttccgggatggggt----------------
A0A2K6QFA2_BCL2L1-      gtgaa--------tgaactcttccgggatggggt----------------
A0A2K6QFA2_BCL2L1-      gtgaa--------tgaactcttccgggatggggt----------------
A0A2K6RW46_BCL2L2-      tctga--------tgaacttttccaagggggccc----------------
A0A2K6RW46_BCL2L2-      tctga--------tgaacttttccaagggggccc----------------
A0A2K6RW46_BCL2L2-      tctga--------tgaacttttccaagggggccc----------------
                            *                     *  *                    

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      gaaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtga
A0A2K6PPL1_MCL1-01      gaaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtga
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      -------------------------cattaactggggaagaattgtaacc
A0A2K6PHG5_BCL2A1-      -------------------------cattaactggggaagaattgtaacc
A0A2K6R5T5_BCL2L10      --------------------------------cggggcgggacgg-----
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      tggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
A0A2K6PPL1_MCL1-01      tggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
A0A2K6R2I6_BCL2-02      ----------------------------gaactgggggaggattgtggcc
A0A2K6R2I6_BCL2-01      ----------------------------gaactgggggaggattgtggcc
A0A2K6QFA2_BCL2L1-      ----------------------------aaactggggtcgcattgtggcc
A0A2K6QFA2_BCL2L1-      ----------------------------aaactggggtcgcattgtggcc
A0A2K6QFA2_BCL2L1-      ----------------------------aaactggggtcgcattgtggcc
A0A2K6RW46_BCL2L2-      ----------------------------caactggggccgccttgtagcc
A0A2K6RW46_BCL2L2-      ----------------------------caactggggccgccttgtagcc
A0A2K6RW46_BCL2L2-      ----------------------------caactggggccgccttgtagcc
                                                                          

A0A2K6PHG5_BCL2A1-      atatttgcatttgaaggtattctcat------------------------
A0A2K6PHG5_BCL2A1-      atatttgcatttgaaggtattctcat------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
A0A2K6PPL1_MCL1-01      ctcatttcttttggtgcctttgtggctaaacacttgaagaccataaacca
A0A2K6R2I6_BCL2-02      ttctttgagttcggtggggtcat---------------------------
A0A2K6R2I6_BCL2-01      ttctttgagttcggtggggtcat---------------------------
A0A2K6QFA2_BCL2L1-      tttttctccttcggcggggcact---------------------------
A0A2K6QFA2_BCL2L1-      tttttctccttcggcggggcact---------------------------
A0A2K6QFA2_BCL2L1-      tttttctccttcggcggggcact---------------------------
A0A2K6RW46_BCL2L2-      ttctttgtctttggggctgcact---------------------------
A0A2K6RW46_BCL2L2-      ttctttgtctttggggctgcact---------------------------
A0A2K6RW46_BCL2L2-      ttctttgtctttggggctgcact---------------------------
                                                                          

A0A2K6PHG5_BCL2A1-      ----------------------------------caagaaacttctacga
A0A2K6PHG5_BCL2A1-      ----------------------------------caagaaacttctacga
A0A2K6R5T5_BCL2L10      -----------------------------gcatccgggaagcgcccacga
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      agaaagttgcatcgaaccattagcagaaagtatcacagacgttctcgtaa
A0A2K6PPL1_MCL1-01      agaaagttgcatcgaaccattagcagaaagtatcacagacgttctcgtaa
A0A2K6R2I6_BCL2-02      -----------------------------gtgtgtggagagcgtcaaccg
A0A2K6R2I6_BCL2-01      -----------------------------gtgtgtggagagcgtcaaccg
A0A2K6QFA2_BCL2L1-      -----------------------------gtgcgtggaaagcgtagacaa
A0A2K6QFA2_BCL2L1-      -----------------------------gtgcgtggaaagcgtagacaa
A0A2K6QFA2_BCL2L1-      -----------------------------gtgcgtggaaagcgtagacaa
A0A2K6RW46_BCL2L2-      -----------------------------gtgtgctgagagtgtcaacaa
A0A2K6RW46_BCL2L2-      -----------------------------gtgtgctgagagtgtcaacaa
A0A2K6RW46_BCL2L2-      -----------------------------gtgtgctgagagtgtcaacaa
                                                                          

A0A2K6PHG5_BCL2A1-      cagcaaattgccccggatgtggatacttataagga--gatttcgtatttt
A0A2K6PHG5_BCL2A1-      cagcaaattgccccggatgtggatacttataagga--gatttcgtatttt
A0A2K6R5T5_BCL2L10      ggccggcac----------------------------ggatggcttttgt
A0A2K6PPL1_MCL1-02      -------------------------------------ggatgggtttgtg
A0A2K6PPL1_MCL1-03      ggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtg
A0A2K6PPL1_MCL1-01      ggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtg
A0A2K6R2I6_BCL2-02      ggagatgtcgcccctggtggacaacatcgccctgt--ggatga-------
A0A2K6R2I6_BCL2-01      ggagatgtcgcccctggtggacaacatcgccctgt--ggatga-------
A0A2K6QFA2_BCL2L1-      ggagatgcaggtattggtgagtcggatcgcagctt--ggatgg-------
A0A2K6QFA2_BCL2L1-      ggagatgcaggtattggtgagtcggatcgcagctt--ggatgg-------
A0A2K6QFA2_BCL2L1-      ggagatgcaggtattggtgagtcggatcgcagctt--ggatgg-------
A0A2K6RW46_BCL2L2-      ggagatggaaccactggtgggacaagtgcaggagt--ggatgg-------
A0A2K6RW46_BCL2L2-      ggagatggaaccactggtgggacaagtgcaggagt--ggatgg-------
A0A2K6RW46_BCL2L2-      ggagatggaaccactggtgggacaagtgcaggagt--ggatgg-------
                                                             *  *         

A0A2K6PHG5_BCL2A1-      gttgctgagttcataatgaataacacaggagaatggataaggcaaaacgg
A0A2K6PHG5_BCL2A1-      gttgctgagttcataatgaataacacaggagaatggataaggcaaaacgg
A0A2K6R5T5_BCL2L10      cacttcttc-------aggaccccctttccgctggctttttggagaa-aa
A0A2K6PPL1_MCL1-02      gagttcttccatgtagagga---cctagaaggtggcatc----agaa-at
A0A2K6PPL1_MCL1-03      gagttcttccatgtagagga---cctagaaggtggcatc----agaa-at
A0A2K6PPL1_MCL1-01      gagttcttccatgtagagga---cctagaaggtggcatc----agaa-at
A0A2K6R2I6_BCL2-02      ----ctgagtacctgaaccggcacctgcacacttggatccaggataacgg
A0A2K6R2I6_BCL2-01      ----ctgagtacctgaaccggcacctgcacacttggatccaggataacgg
A0A2K6QFA2_BCL2L1-      ----ccacttatctgaatgaccacctagagccttggatccaggagaacgg
A0A2K6QFA2_BCL2L1-      ----ccacttatctgaatgaccacctagagccttggatccaggagaacgg
A0A2K6QFA2_BCL2L1-      ----ccacttatctgaatgaccacctagagccttggatccaggagaacgg
A0A2K6RW46_BCL2L2-      ----tggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6RW46_BCL2L2-      ----tggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6RW46_BCL2L2-      ----tggcctacctggagacgcggctggctgactggatccacagcagtgg
                                                          *  *       *    

A0A2K6PHG5_BCL2A1-      aggct-ggga--aaatggctttgtaaagaagtttgaacctaaatctgg--
A0A2K6PHG5_BCL2A1-      aggctggggg--aaatggc-------acaatcacatgcctatg-ctag--
A0A2K6R5T5_BCL2L10      ctgctgatcc-----aggctttcctggcatgcttgttaacaacagccttc
A0A2K6PPL1_MCL1-02      gtgctg---c-----tggcttt-------------------------tgc
A0A2K6PPL1_MCL1-03      gtgctg---c-----tggcttt-------------------------tgc
A0A2K6PPL1_MCL1-01      gtgctg---c-----tggcttt-------------------------tgc
A0A2K6R2I6_BCL2-02      aggctggcgt------ac---------aatgt------------------
A0A2K6R2I6_BCL2-01      aggctgggat------gcctttgtggaactgtacggccc-----------
A0A2K6QFA2_BCL2L1-      cggctgggac------acttttgtggaactctatgggaacaatgc-----
A0A2K6QFA2_BCL2L1-      cggctgggac------acttttgtggaactctatgggaacaatgc-----
A0A2K6QFA2_BCL2L1-      cggctgggac------acttttgtggaactctatgggaacaatgc-----
A0A2K6RW46_BCL2L2-      gggctgggcg------gagttcacagctctatacggggacggggccctgg
A0A2K6RW46_BCL2L2-      gggctgggcg------gagttcacagctctatacggggacggggccctgg
A0A2K6RW46_BCL2L2-      gggctgggagctggaagctatcaaagctcgagtcagggagatgga---gg
                          ***                                             

A0A2K6PHG5_BCL2A1-      --------------------------------------ctggatgacttt
A0A2K6PHG5_BCL2A1-      --------------------------------------tagagtcagtgg
A0A2K6R5T5_BCL2L10      ggttacct------------------------------ctggacacgatt
A0A2K6PPL1_MCL1-02      aggtgttg------------------------------ctgg--------
A0A2K6PPL1_MCL1-03      aggtgttg------------------------------ctgg--------
A0A2K6PPL1_MCL1-01      aggtgttg------------------------------ctgg--------
A0A2K6R2I6_BCL2-02      ----------------------------------------gcacgtggt-
A0A2K6R2I6_BCL2-01      --------------------------------------cagcatgcggcc
A0A2K6QFA2_BCL2L1-      -agcagccgagagccgaaagggcc--------------aggagcgcttca
A0A2K6QFA2_BCL2L1-      -agcagccgagagccgaaagggcc--------------aggagcgcttca
A0A2K6QFA2_BCL2L1-      -agcagccgagagccgaaagggcc--------------aggagcgcttca
A0A2K6RW46_BCL2L2-      aggaggcgcggcgtctgcgggag---------------gggaactgggca
A0A2K6RW46_BCL2L2-      aggaggcgcggcgtctgcgggag---------------gggaactgggca
A0A2K6RW46_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
                                                                *         

A0A2K6PHG5_BCL2A1-      tctagaag----ttacaggaaagatctgtg--------------------
A0A2K6PHG5_BCL2A1-      cccacaag----aagaagaaaatggctttg--------------------
A0A2K6R5T5_BCL2L10      attatgagt---ttt---aaaatttttaac--------------------
A0A2K6PPL1_MCL1-02      agtaggagctggttt---ggcatatctaat--------------------
A0A2K6PPL1_MCL1-03      agtaggagctggttt---ggcatatctaat--------------------
A0A2K6PPL1_MCL1-01      agtaggagctggttt---ggcatatctaat--------------------
A0A2K6R2I6_BCL2-02      ------------------gccgcttcag----------------------
A0A2K6R2I6_BCL2-01      tctgtttgatttctcctggctgtctctgaa-----------gactctgct
A0A2K6QFA2_BCL2L1-      accgctgg-----ttcctgacgggcatgac--------------------
A0A2K6QFA2_BCL2L1-      accgctgg-----ttcctgacgggcatgac--------------------
A0A2K6QFA2_BCL2L1-      accgctgg-----ttcctgacgggcatgac--------------------
A0A2K6RW46_BCL2L2-      tcagtgag----------gacagtgctgac--------------------
A0A2K6RW46_BCL2L2-      tcagtgag----------gacagtgctgac--------------------
A0A2K6RW46_BCL2L2-      aatatgagtccacctccaggcaatgctggcccagtgatcatgtccattga
                                                                          

A0A2K6PHG5_BCL2A1-      ------------------------------------aaatgctatctctc
A0A2K6PHG5_BCL2A1-      ------------------------------------taa-----------
A0A2K6R5T5_BCL2L10      -----------------------------------ccacttctacctgcc
A0A2K6PPL1_MCL1-02      -----------------------------------aagat------agcc
A0A2K6PPL1_MCL1-03      -----------------------------------aagat------ag--
A0A2K6PPL1_MCL1-01      -----------------------------------aagat------ag--
A0A2K6R2I6_BCL2-02      ---------------------------------------------gggat
A0A2K6R2I6_BCL2-01      cagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggcc
A0A2K6QFA2_BCL2L1-      ---------tgtggccggcg----------------tggttctgctgggc
A0A2K6QFA2_BCL2L1-      ---------tgtggccggcg----------------tggttctgctgggc
A0A2K6QFA2_BCL2L1-      ---------tgtggccggcg----------------tggttctgctgggc
A0A2K6RW46_BCL2L2-      ---------gggggccg-------------------tggcactgggggcc
A0A2K6RW46_BCL2L2-      ---------gggggccg-------------------tggcactgggggcc
A0A2K6RW46_BCL2L2-      ggagaagatggaggctgatgcccgttccatctatgttggcaatgtggact
                                                                          

A0A2K6PHG5_BCL2A1-      ctgaagcaatactgt-----------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      caactg--------------------------------------------
A0A2K6PPL1_MCL1-02      ttactg--------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      gtgat---------------------------------------------
A0A2K6R2I6_BCL2-01      acaag---------------------------------------------
A0A2K6QFA2_BCL2L1-      tcact---------------------------------------------
A0A2K6QFA2_BCL2L1-      tcact---------------------------------------------
A0A2K6QFA2_BCL2L1-      tcact---------------------------------------------
A0A2K6RW46_BCL2L2-      ctggt---------------------------------------------
A0A2K6RW46_BCL2L2-      ctggt---------------------------------------------
A0A2K6RW46_BCL2L2-      atggtgcaacagcagaagagctggaagctcactttcatggctgtggatca
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      ---------------------------aactgtaggggcctt--------
A0A2K6RW46_BCL2L2-      ---------------------------aactgtaggggcctt--------
A0A2K6RW46_BCL2L2-      gtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagg
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      gtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttgg
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      ccttagatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaa
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      cgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagc
                                                                          

A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPL1_MCL1-02      --------------------------------------------------
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      --------------------------------------------------
A0A2K6R2I6_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      --------------------------------------------------
A0A2K6RW46_BCL2L2-      ccgctaccgcgcccggaccaccaactacaacagttcccgctctcgcttct
                                                                          

A0A2K6PHG5_BCL2A1-      -----------------------------------------------tga
A0A2K6PHG5_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      -----------------------------------------------tga
A0A2K6PPL1_MCL1-02      -----------------------------------------------taa
A0A2K6PPL1_MCL1-03      --------------------------------------------------
A0A2K6PPL1_MCL1-01      --------------------------------------------------
A0A2K6R2I6_BCL2-02      -----------------------------------------------tga
A0A2K6R2I6_BCL2-01      -----------------------------------------------tga
A0A2K6QFA2_BCL2L1-      -------cttcagtcggaaa---------------------------tga
A0A2K6QFA2_BCL2L1-      -------cttcagtcggaaa---------------------------tga
A0A2K6QFA2_BCL2L1-      -------cttcagtcggaaa---------------------------tga
A0A2K6RW46_BCL2L2-      -------ttttgctagcaag---------------------------tga
A0A2K6RW46_BCL2L2-      -------ttttgctagcaag---------------------------tga
A0A2K6RW46_BCL2L2-      acagtggttttaacagcaggccccggggtcgcgtctacaggtcaggatag
                                                                          

© 1998-2018