Dataset for CDS BCL-2-like of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6LV22_BCL2A1-      atgacagactgtg-----------------aatttggatatatttac---
A0A2K6LV22_BCL2A1-      atgacagactgtg-----------------aatttggatatatttac---
A0A2K6M5H5_BCL2L10      atggctgaccc-----------------gttgcgggagcgcaccaccgtg
A0A2K6KRW9_MCL1-02      atgtttggctt------------------caaaagaaacgcggtaatcgg
A0A2K6KRW9_MCL1-01      atgtttggctt------------------caaaagaaacgcggtaatcgg
A0A2K6KRW9_MCL1-03      atgtttggctt------------------caaaagaaacgcggtaatcgg
A0A2K6KHG1_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      ------------------atgtctcagagcaaccgggagctggtggttga
A0A2K6MEE6_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K6MEE6_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga

A0A2K6LV22_BCL2A1-      --------------aggctagctcaggactatttgcag------------
A0A2K6LV22_BCL2A1-      --------------aggctagctcaggactatttgcag------------
A0A2K6M5H5_BCL2L10      gctgacccgttgc-gcgagcgcaccgagcggttgctgg------------
A0A2K6KRW9_MCL1-02      actcaacctctactgtgggggggccg---gcttggggg------------
A0A2K6KRW9_MCL1-01      actcaacctctactgtgggggggccg---gcttggggg------------
A0A2K6KRW9_MCL1-03      actcaacctctactgtgggggggccg---gcttggggg------------
A0A2K6KHG1_BCL2-01      gtacatccactat-aagctgtcgcagaggggctacgagtggga-------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      ctttctctcctac-aagctttcccagaaaggatacagctggagtcagttt
A0A2K6MEE6_BCL2L2-      ctttgtaggttat-aagctgaggcagaagggttatgtc------------
A0A2K6MEE6_BCL2L2-      ctttgtaggttat-aagctgaggcagaagggttatgtc------------

A0A2K6LV22_BCL2A1-      -----tacgtc--ctgcagataccacaacc--------------------
A0A2K6LV22_BCL2A1-      -----tacgtc--ctgcagataccacaacc--------------------
A0A2K6M5H5_BCL2L10      ------ccgactatctggggtgctgcgc--ccgggaacccggc-------
A0A2K6KRW9_MCL1-02      ------ccggc-agcggcggcgccacccctccgggagggcggcttttggc
A0A2K6KRW9_MCL1-01      ------ccggc-agcggcggcgccacccctccgggagggcggcttttggc
A0A2K6KRW9_MCL1-03      ------ccggc-agcggcggcgccacccctccgggagggcggctttt---
A0A2K6KHG1_BCL2-01      -----tgcgggagatgtgggcgccgcgacccctggggccgccc-------
A0A2K6LPM4_BCL2L1-      ----atgtggaagagaacaggactgaggccccagaa--------------
A0A2K6LPM4_BCL2L1-      agtgatgtggaagagaacaggactgaggccccagaa--------------
A0A2K6MEE6_BCL2L2-      -----tgtgga----------gct--ggccctgggg--------------
A0A2K6MEE6_BCL2L2-      -----tgtgga----------gct--ggccctgggg--------------
                                *             *                           

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      tacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
A0A2K6KRW9_MCL1-01      tacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --ccgcaccgggcatcttctcctcccagcccgggcacacgccccatcccg
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      ---------tggatcgggtccaagcaaaacgtccagagt-gctacaaaag
A0A2K6LV22_BCL2A1-      ---------tggatcgggtccaagcaaaacgtccagagt-gctacaaaag
A0A2K6M5H5_BCL2L10      ------------------------------acccccga--gccgaggccg
A0A2K6KRW9_MCL1-02      gcacggtgattggcgaaagcgccggcgcaagccccccg--gccg----cc
A0A2K6KRW9_MCL1-01      gcacggtgattggcgaaagcgccggcgcaagccccccg--gccg----cc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      ccgcgtcccgggacccg---gtcgccaggacctcgccgctgccgaccccg
A0A2K6LPM4_BCL2L1-      ---------gggactgaatcggagatggagacccccagt-gccatcaatg
A0A2K6LPM4_BCL2L1-      ---------gggactgaatcggagatggagacccccagt-gccatcaatg
A0A2K6MEE6_BCL2L2-      ---------agggccca---gcagct---gacccgctgc-ac--------
A0A2K6MEE6_BCL2L2-      ---------agggccca---gcagct---gacccgctgc-ac--------

A0A2K6LV22_BCL2A1-      gttgcattctcagtccagaaagaagtggaa--------------------
A0A2K6LV22_BCL2A1-      gttgcattctcagtccagaaagaagtggaa--------------------
A0A2K6M5H5_BCL2L10      tccacgcccgaggcc------gccgtgctg----cgctccg---------
A0A2K6KRW9_MCL1-02      ctcacgccagacgcccggagggtcgcgcggccgccgcccat---------
A0A2K6KRW9_MCL1-01      ctcacgccagacgcccggagggtcgcgcggccgccgcccat---------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      gctgcccccgccgcc------gccgcggggcctgcgctcagcccggtgcc
A0A2K6LPM4_BCL2L1-      gcaacccatcct--------------------------------------
A0A2K6LPM4_BCL2L1-      gcaacccatcctggc------acctggtggacagccccgcggtgaatgga
A0A2K6MEE6_BCL2L2-      -caagccatgcgggc------a----------------------------
A0A2K6MEE6_BCL2L2-      -caagccatgcgggc------a----------------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      acctgtggtc----------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      gccactggccacagcagcagtttggatgcccgggaggtgatccccatggc
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      --------------------aagaatctgaagccatgcttggacaatgtt
A0A2K6LV22_BCL2A1-      --------------------aagaatctgaagccatgcttggacaatgtt
A0A2K6M5H5_BCL2L10      ---------------------------cggcggccaggtt--acggcagc
A0A2K6KRW9_MCL1-02      ---------------------------tggcgccgaggtc--cc--cgac
A0A2K6KRW9_MCL1-01      ---------------------------tggcgccgaggtc--cc--cgac
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      -------cacctgaccctccgccaggccggtgacgacttctcccgccgct
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      agcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggt
A0A2K6MEE6_BCL2L2-      -------------------------gctggagatgagttcgagacccgct
A0A2K6MEE6_BCL2L2-      -------------------------gctggagatgagttcgagacccgct

A0A2K6LV22_BCL2A1-      aatg----------------------------------ttgcatccatag
A0A2K6LV22_BCL2A1-      aatg----------------------------------ttgcatccatag
A0A2K6M5H5_BCL2L10      tccaccggtccttc-------------ttc-------tctgcctacctcg
A0A2K6KRW9_MCL1-02      gtcaccgggacccccgcgaggctgcttttc-------tttgcgcccaccc
A0A2K6KRW9_MCL1-01      gtcaccgggacccccgcgaggctgcttttc-------tttgcgcccaccc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      accgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttc
A0A2K6LPM4_BCL2L1-      -----------------------------------------------ggg
A0A2K6LPM4_BCL2L1-      accggcgggcgttcagtgacctgacatcccagctccacatcaccccaggg
A0A2K6MEE6_BCL2L2-      tccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggc
A0A2K6MEE6_BCL2L2-      tccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggc

A0A2K6LV22_BCL2A1-      acactgccagaacactattc---------aatcaagtgatggaaaa----
A0A2K6LV22_BCL2A1-      acactgccagaacactattc---------aatcaagtgatggaaaa----
A0A2K6M5H5_BCL2L10      gctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgt-
A0A2K6KRW9_MCL1-02      gccgcgcggcgcctcttgaggagatggaagccccggccgccgacgccatc
A0A2K6KRW9_MCL1-01      gccgcgcggcgcctcttgaggagatggaagccccggccgccgacgccatc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      accgcgcggggacgcttt-----------gccacggtggtggagga----
A0A2K6LPM4_BCL2L1-      acagcatatcagagcttt-----------gaacaggtagtgaatga----
A0A2K6LPM4_BCL2L1-      acagcatatcagagcttt-----------gaacaggtagtgaatga----
A0A2K6MEE6_BCL2L2-      tcagcgcagcaacgcttc-----------acccaggtctctgatga----
A0A2K6MEE6_BCL2L2-      tcagcgcagcaacgcttc-----------acccaggtctctgatga----

A0A2K6LV22_BCL2A1-      ---------------------------------------ggagtttgaag
A0A2K6LV22_BCL2A1-      ---------------------------------------ggagtttgaag
A0A2K6M5H5_BCL2L10      ---------------------------------------gctctccgaca
A0A2K6KRW9_MCL1-02      atgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaa
A0A2K6KRW9_MCL1-01      atgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaa
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      ---------------------------------------gctcttcaggg
A0A2K6LPM4_BCL2L1-      ---------------------------------------actcttccggg
A0A2K6LPM4_BCL2L1-      ---------------------------------------actcttccggg
A0A2K6MEE6_BCL2L2-      ---------------------------------------acttttccaag
A0A2K6MEE6_BCL2L2-      ---------------------------------------acttttccaag

A0A2K6LV22_BCL2A1-      at------------ggcatcattaactggggaagaattgtaaccatattt
A0A2K6LV22_BCL2A1-      at------------ggcatcattaactggggaagaattgtaaccatattt
A0A2K6M5H5_BCL2L10      gc---------cccggcccc---acctggggcagggtggtgtcgctggtg
A0A2K6KRW9_MCL1-02      gcggccggctgtcctgcccc---tgctggagttggtcggggaatctggta
A0A2K6KRW9_MCL1-01      gcggccggctgtcctgcccc---tgctggagttggtcggggaatctggta
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      ac------------ggggtg---aactgggggaggattgtggccttcttt
A0A2K6LPM4_BCL2L1-      at------------ggggta---aactggggtcgcattgtggcctttttc
A0A2K6LPM4_BCL2L1-      at------------ggggta---aactggggtcgcattgtggcctttttc
A0A2K6MEE6_BCL2L2-      gg------------ggcccc---aactggggccgccttgtagccttcttt
A0A2K6MEE6_BCL2L2-      gg------------ggcccc---aactggggccgccttgtagccttcttt

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      atagctccagtacggatgggtcactaccctcgacgccgccgccagcagag
A0A2K6KRW9_MCL1-01      atagctccagtacggatgggtcactaccctcgacgccgccgccagcagag
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      -------------------------------------------------g
A0A2K6LV22_BCL2A1-      -------------------------------------------------g
A0A2K6M5H5_BCL2L10      -------------------------------------------------a
A0A2K6KRW9_MCL1-02      gaggaggaggacgagttgtaccggcagtcactggaaattatctctcggta
A0A2K6KRW9_MCL1-01      gaggaggaggacgagttgtaccggcagtcactggaaattatctctcggta
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      -------------------------------------------------g
A0A2K6LPM4_BCL2L1-      -------------------------------------------------t
A0A2K6LPM4_BCL2L1-      -------------------------------------------------t
A0A2K6MEE6_BCL2L2-      -------------------------------------------------g
A0A2K6MEE6_BCL2L2-      -------------------------------------------------g

A0A2K6LV22_BCL2A1-      catttgaaggtattct-----catcaagaaact-----------------
A0A2K6LV22_BCL2A1-      catttgaaggtattct-----catcaagaaact-----------------
A0A2K6M5H5_BCL2L10      ccttcgcggggacgctgctggagagagagccgctggtgacagcctggtgg
A0A2K6KRW9_MCL1-02      ccttcgggagcaggccaccggcgccaaggacac-----aaagccaatggg
A0A2K6KRW9_MCL1-01      ccttcgggagcaggccaccggcgccaaggacac-----aaagccaatggg
A0A2K6KRW9_MCL1-03      ------------ggccaccggcgccaaggacac-----aaagccaatggg
A0A2K6KHG1_BCL2-01      agttcggtggggtcatgt--gtgtggagagcgt-----------------
A0A2K6LPM4_BCL2L1-      ccttcggcggggcactgt--gcgtggaaagcgt-----------------
A0A2K6LPM4_BCL2L1-      ccttcggcggggcactgt--gcgtggaaagcgt-----------------
A0A2K6MEE6_BCL2L2-      tctttggggctgcactgt--gtgctgagagtgt-----------------
A0A2K6MEE6_BCL2L2-      tctttggggctgcactgt--gtgctgagagtgt-----------------

A0A2K6LV22_BCL2A1-      -----------tctacgacagcaaattgccccggatgtggatacttataa
A0A2K6LV22_BCL2A1-      -----------tctacgacagcaaattgccccggatgtggatacttataa
A0A2K6M5H5_BCL2L10      aagaagcggagcttccagccgcgg----ctgaagg------agcaggagg
A0A2K6KRW9_MCL1-02      caggtctggggccaccagcaggaaggctctggagaccttacgacgggtgg
A0A2K6KRW9_MCL1-01      caggtctggggccaccagcaggaaggctctggagaccttacgacgggtgg
A0A2K6KRW9_MCL1-03      caggtctggggccaccagcaggaaggctctggagaccttacgacgggtgg
A0A2K6KHG1_BCL2-01      ---------------caaccg---------ggagatgtcgcccctggtgg
A0A2K6LPM4_BCL2L1-      ---------------agacaa---------ggagatgcaggtattggtga
A0A2K6LPM4_BCL2L1-      ---------------agacaa---------ggagatgcaggtattggtga
A0A2K6MEE6_BCL2L2-      ---------------caacaa---------ggagatggaaccactggtgg
A0A2K6MEE6_BCL2L2-      ---------------caacaa---------ggagatggaaccactggtgg
                                          *              *                

A0A2K6LV22_BCL2A1-      g-gagatttcgtat---------tttgttgctgagttcataatgaata--
A0A2K6LV22_BCL2A1-      g-gagatttcgtat---------tttgttgctgagttcataatgaata--
A0A2K6M5H5_BCL2L10      gcgacgtcgcccgggactgccagcgcctggtggccttgctgagctcgc--
A0A2K6KRW9_MCL1-02      gggatggcgtgcag---cgcaaccacgagacggctttccaa---------
A0A2K6KRW9_MCL1-01      gggatggcgtgcag---cgcaaccacgagacggctttccaaggcatgctt
A0A2K6KRW9_MCL1-03      gggatggcgtgcag---cgcaaccacgagacggctttccaaggcatgctt
A0A2K6KHG1_BCL2-01      acaacatcgccctg---------tggatgactgagtacctgaaccggc--
A0A2K6LPM4_BCL2L1-      gtcggatcgcagct---------tggatggccacttatctgaatgacc--
A0A2K6LPM4_BCL2L1-      gtcggatcgcagct---------tggatggccacttatctgaatgacc--
A0A2K6MEE6_BCL2L2-      gacaagtgcaggag---------tggatggtggcctacctggagacgc--
A0A2K6MEE6_BCL2L2-      gacaagtgcaggag---------tggatggtggcctacctggagacgc--

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      cggaaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagt
A0A2K6KRW9_MCL1-03      cggaaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagt
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      gatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtga
A0A2K6KRW9_MCL1-03      gatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtga
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      ctctcatttcttttggtgcctttgtggctaaacacttgaagaccataaac
A0A2K6KRW9_MCL1-03      ctctcatttcttttggtgcctttgtggctaaacacttgaagaccataaac
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      -------------------------------------------ggctcac
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      caagaaagttgcatcgaaccattagcagaaagtatcacagacgttctcgt
A0A2K6KRW9_MCL1-03      caagaaagttgcatcgaaccattagcagaaagtatcacagacgttctcgt
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      -----acacaggagaatggataaggcaaaacggaggct-ggga--aaatg
A0A2K6LV22_BCL2A1-      -----acacaggagaatggataaggcaaaacggaggctggggg--aaatg
A0A2K6M5H5_BCL2L10      ggggcagcaccgcgcctggcttcaggctcagggcggctgggat------g
A0A2K6KRW9_MCL1-02      ---------------------------------------ggat------g
A0A2K6KRW9_MCL1-01      aaggacaaaacgggactggctagttaaacaaagaggctgggat------g
A0A2K6KRW9_MCL1-03      aaggacaaaacgggactggctagttaaacaaagaggctgggat------g
A0A2K6KHG1_BCL2-01      -----acctgcacacttggatccaggataacggaggctgggat------g
A0A2K6LPM4_BCL2L1-      -----acctagagccttggatccaggagaacggcggctgggac------a
A0A2K6LPM4_BCL2L1-      -----acctagagccttggatccaggagaacggcggctgggac------a
A0A2K6MEE6_BCL2L2-      -----ggctggctgactggatccacagcagtgggggctgggagctggaag
A0A2K6MEE6_BCL2L2-      -----ggctggctgactggatccacagcagtgggggctgggcg------g

A0A2K6LV22_BCL2A1-      gctttgtaaagaagtttgaacctaaatc----------------------
A0A2K6LV22_BCL2A1-      gc-------acaatcacatgcctatg-c----------------------
A0A2K6M5H5_BCL2L10      gcttttgtcacttcttc---------------------------------
A0A2K6KRW9_MCL1-02      ggtttgtggagttcttc---------------------------catgta
A0A2K6KRW9_MCL1-01      ggtttgtggagttcttc---------------------------catgta
A0A2K6KRW9_MCL1-03      ggtttgtggagttcttc---------------------------catgta
A0A2K6KHG1_BCL2-01      cctttgtggaactgtacggcccca--------------------------
A0A2K6LPM4_BCL2L1-      cttttgtggaactctatgggaacaatgc------agcagccgagagccga
A0A2K6LPM4_BCL2L1-      cttttgtggaactctatgggaacaatgc------agcagccgagagccga
A0A2K6MEE6_BCL2L2-      ctatcaaagctcgagtcagggagatgga---ggaagaagctgagaagcta
A0A2K6MEE6_BCL2L2-      agttcacagctctatacggggacggggccctggaggaggcgcggcgtctg

A0A2K6LV22_BCL2A1-      ----------------------------------tggctggatgactttt
A0A2K6LV22_BCL2A1-      ----------------------------------tagtagagtcagtggc
A0A2K6M5H5_BCL2L10      -aggaccc-----------------ccttt----ccgctgg----ctttt
A0A2K6KRW9_MCL1-02      gaggacctagaaggtggcatcagaaatgtg----ctgctgg----ctttt
A0A2K6KRW9_MCL1-01      gaggacctagaaggtggcatcagaaatgtg----ctgctgg----ctttt
A0A2K6KRW9_MCL1-03      gaggacctagaaggtggcatcagaaatgtg----ctgctgg----ctttt
A0A2K6KHG1_BCL2-01      -----------------------gcatgcggcctctgtttg-atttctcc
A0A2K6LPM4_BCL2L1-      aagggcc--------------aggagcgcttcaaccgctgg-----ttcc
A0A2K6LPM4_BCL2L1-      aagggcc--------------aggagcgcttcaaccgctgg-----ttcc
A0A2K6MEE6_BCL2L2-      aaggagctacagaacgaggtagagaagcagatgaatatgagtccacctcc
A0A2K6MEE6_BCL2L2-      cgggag---------------gggaactgggcatcagtgag---------

A0A2K6LV22_BCL2A1-      ctagaagt----------------------------------tacaggaa
A0A2K6LV22_BCL2A1-      ccatagga----------------------------------agaagaaa
A0A2K6M5H5_BCL2L10      tggagaaaactgc-----------------------------tgatccag
A0A2K6KRW9_MCL1-02      --gcaggtgttgc-----------------------------tggagtag
A0A2K6KRW9_MCL1-01      --gcaggtgttgc-----------------------------tggagtag
A0A2K6KRW9_MCL1-03      --gcaggtgttgc-----------------------------tggagtag
A0A2K6KHG1_BCL2-01      tggctgtctc--------------------------------tgaagact
A0A2K6LPM4_BCL2L1-      tgacgggcatgac-----------------------------tgtggccg
A0A2K6LPM4_BCL2L1-      tgacgggcatgac-----------------------------tgtggccg
A0A2K6MEE6_BCL2L2-      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
A0A2K6MEE6_BCL2L2-      -gacagtgctgac-----------------------------gggggccg

A0A2K6LV22_BCL2A1-      a------------------gatctgtgaaatgctatctct----------
A0A2K6LV22_BCL2A1-      a------------------tggctttgtaa--------------------
A0A2K6M5H5_BCL2L10      --gctttcc----------tggcat--------gcttgtt----------
A0A2K6KRW9_MCL1-02      gagctggtt----------tggcat--------atctaat----------
A0A2K6KRW9_MCL1-01      gagctggtt----------tggcat--------atctaat----------
A0A2K6KRW9_MCL1-03      gagctggtt----------tggcat--------atctaat----------
A0A2K6KHG1_BCL2-01      ctgctcagtt---------tggccctggtgggagcttgca----------
A0A2K6LPM4_BCL2L1-      gcg----------------tggttctgctgg--gctcact----------
A0A2K6LPM4_BCL2L1-      gcg----------------tggttctgctgg--gctcact----------
A0A2K6MEE6_BCL2L2-      atgcccgttccatctatgttggcaatgtgga--ctatggtgcaacagcag
A0A2K6MEE6_BCL2L2-      -------------------tggcactggggg--ccctggt----------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      aagagctggaagctcactttcatggctgtggatcagtcaaccgtgttacc
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      ------------aacaacagccttcgg-----------------------
A0A2K6KRW9_MCL1-02      ------------aa------------------------------------
A0A2K6KRW9_MCL1-01      ------------aa------------------------------------
A0A2K6KRW9_MCL1-03      ------------aa------------------------------------
A0A2K6KHG1_BCL2-01      -----------tcaccctgggtgccta-----------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      atactctgtgacaaatttagtggccatcccaaagggtttgcgtatataga
A0A2K6MEE6_BCL2L2-      ------------aactgtaggggcctt-----------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      gttctcagacaaagagtcagtgaggacttccttggccttagatgagtccc
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      tatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagacca
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6LPM4_BCL2L1-      --------------------------------------------------
A0A2K6MEE6_BCL2L2-      ggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccg
A0A2K6MEE6_BCL2L2-      --------------------------------------------------

A0A2K6LV22_BCL2A1-      ------------------------------------------------cc
A0A2K6LV22_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      ------------------------------------------ttacctct
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6KHG1_BCL2-01      ------------------------------------------tctgggcc
A0A2K6LPM4_BCL2L1-      ------------------------------------------cttcagtc
A0A2K6LPM4_BCL2L1-      ------------------------------------------cttcagtc
A0A2K6MEE6_BCL2L2-      gaccaccaactacaacagttcccgctctcgcttctacagtggttttaaca
A0A2K6MEE6_BCL2L2-      ------------------------------------------ttttgcta

A0A2K6LV22_BCL2A1-      tgaag------------------caatactgttga
A0A2K6LV22_BCL2A1-      -----------------------------------
A0A2K6M5H5_BCL2L10      ggaca------------------cgattattatga
A0A2K6KRW9_MCL1-02      -gata------------------gccttactgtaa
A0A2K6KRW9_MCL1-01      -gata------------------g-----------
A0A2K6KRW9_MCL1-03      -gata------------------g-----------
A0A2K6KHG1_BCL2-01      acaag---------------------------tga
A0A2K6LPM4_BCL2L1-      ggaaa---------------------------tga
A0A2K6LPM4_BCL2L1-      ggaaa---------------------------tga
A0A2K6MEE6_BCL2L2-      gcaggccccggggtcgcgtctacaggtcaggatag
A0A2K6MEE6_BCL2L2-      gcaag---------------------------tga

© 1998-2019