Dataset for CDS BCL-2-like of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6LV19_BCL2A1-      atgacagac--------------------------------------tgt
A0A2K6LV19_BCL2A1-      atgacagac--------------------------------------tgt
A0A2K6M5H5_BCL2L10      atggctgac--------------------------------ccgttgcgg
A0A2K6KRW9_MCL1-01      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6KRW9_MCL1-02      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6KHG1_BCL2-01      atggcgcacgctggga---------------gaacagggtac-gataacc
A0A2K6ME72_BCL2L2-      atggcgacccc----a---------------gcctcggccccagacacac
A0A2K6ME72_BCL2L2-      atggcgacccc----a---------------gcctcggccccagacacac
                        ***     *                                         

A0A2K6LV19_BCL2A1-      gaatttggatatatttacaggc----------------------------
A0A2K6LV19_BCL2A1-      gaatttggatatatttacaggc----------------------------
A0A2K6M5H5_BCL2L10      gagcg-caccaccgtggctgac--ccgttgcgcgagcgcacc----gagc
A0A2K6KRW9_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6KRW9_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6KHG1_BCL2-01      gggag-----atagtgatgaagtac----------------------atc
A0A2K6ME72_BCL2L2-      gggct-----ctggtggcagacttt----------------------gta
A0A2K6ME72_BCL2L2-      gggct-----ctggtggcagacttt----------------------gta
                        *                                                 

A0A2K6LV19_BCL2A1-      ------tagctcaggactatttgcagtacgtcc-----------------
A0A2K6LV19_BCL2A1-      ------tagctcaggactatttgcagtacgtcc-----------------
A0A2K6M5H5_BCL2L10      ggttgctggccgactatctggggtgctgcgccc-----------------
A0A2K6KRW9_MCL1-01      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K6KRW9_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K6KHG1_BCL2-01      cactataagctgtc--gcagaggggctacgagt-----------------
A0A2K6ME72_BCL2L2-      ggttataagctgag--gcagaagggttatgtct-----------------
A0A2K6ME72_BCL2L2-      ggttataagctgag--gcagaagggttatgtct-----------------
                                **            *   *  *                    

A0A2K6LV19_BCL2A1-      -----------------------------------------------tgc
A0A2K6LV19_BCL2A1-      -----------------------------------------------tgc
A0A2K6M5H5_BCL2L10      -gggaacccggcac---------------ccccgagccga-------ggc
A0A2K6KRW9_MCL1-01      ggggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggc
A0A2K6KRW9_MCL1-02      ggggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggc
A0A2K6KHG1_BCL2-01      -gggatgcgggagatgtgggcgccgcgacccctgg------------ggc
A0A2K6ME72_BCL2L2-      -gtggagctgg------------------ccctgg------------gg-
A0A2K6ME72_BCL2L2-      -gtggagctgg------------------ccctgg------------gg-
                                                                        * 

A0A2K6LV19_BCL2A1-      agataccacaacctggatc-------------------------------
A0A2K6LV19_BCL2A1-      agataccacaacctggatc-------------------------------
A0A2K6M5H5_BCL2L10      cgtc--cacgcccgaggcc-------------------------------
A0A2K6KRW9_MCL1-01      cgccctcacgccagacgcccgg----------------------------
A0A2K6KRW9_MCL1-02      cgccctcacgccagacgcccgg----------------------------
A0A2K6KHG1_BCL2-01      cgcccccgcaccgggcatcttctcctcccagcccgggcacacgccccatc
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------gggtccaagcaa------------
A0A2K6LV19_BCL2A1-      --------------------------gggtccaagcaa------------
A0A2K6M5H5_BCL2L10      -----------------------------gccgtgctg----cgctccgc
A0A2K6KRW9_MCL1-01      --------------------------agggtcgcgcggccgccgcccatt
A0A2K6KRW9_MCL1-02      --------------------------agggtcgcgcggccgccgcccatt
A0A2K6KHG1_BCL2-01      ccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccg
A0A2K6ME72_BCL2L2-      --------------------------agggcccagcagctgac-------
A0A2K6ME72_BCL2L2-      --------------------------agggcccagcagctgac-------
                                                       *  **              

A0A2K6LV19_BCL2A1-      aacgtccagagtgctacaaaaggttgcattctcagtccagaaaga-----
A0A2K6LV19_BCL2A1-      aacgtccagagtgctacaaaaggttgcattctcagtccagaaaga-----
A0A2K6M5H5_BCL2L10      ggcggccaggttacggcagc------------------------------
A0A2K6KRW9_MCL1-01      ggcgccgaggtccc--cgac------------------------------
A0A2K6KRW9_MCL1-02      ggcgccgaggtccc--cgac------------------------------
A0A2K6KHG1_BCL2-01      gctgcccccgccgccgccgcggggcctgcgctcagcccggtgccacctgt
A0A2K6ME72_BCL2L2-      ----------ccgctgcaccaagccatgcgggca----------------
A0A2K6ME72_BCL2L2-      ----------ccgctgcaccaagccatgcgggca----------------
                                     *  *                                 

A0A2K6LV19_BCL2A1-      ----------------------agtggaaaagaat----------ctgaa
A0A2K6LV19_BCL2A1-      ----------------------agtggaaaagaat----------ctgaa
A0A2K6M5H5_BCL2L10      --tccaccggtccttc------------------ttctctgcctacctcg
A0A2K6KRW9_MCL1-01      --gtcaccgggacccccgcgaggctgct-----tttctttgcgcccaccc
A0A2K6KRW9_MCL1-02      --gtcaccgggacccccgcgaggctgct-----tttctttgcgcccaccc
A0A2K6KHG1_BCL2-01      ggtccacctgaccctccgccaggccggtgacgacttctcccgccgctacc
A0A2K6ME72_BCL2L2-      ----------------------gctggagatgagttcgagacccgcttcc
A0A2K6ME72_BCL2L2-      ----------------------gctggagatgagttcgagacccgcttcc
                                                          *          *    

A0A2K6LV19_BCL2A1-      gccatg-------cttggacaatgttaatgttgcatccatagacactgcc
A0A2K6LV19_BCL2A1-      gccatg-------cttggacaatgttaatgttgcatccatagacactgcc
A0A2K6M5H5_BCL2L10      gctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgt-
A0A2K6KRW9_MCL1-01      gccgcgcggcgcctcttgaggagatggaagccccggccgccgacgccatc
A0A2K6KRW9_MCL1-02      gccgcgcggcgcctcttgaggagatggaagccccggccgccgacgccatc
A0A2K6KHG1_BCL2-01      gccgcga------cttcgccgagatgtccag-ccagctgcacctgacgcc
A0A2K6ME72_BCL2L2-      ggcgcac------cttctctgatctggcggc-tcagctgcatgtgacccc
A0A2K6ME72_BCL2L2-      ggcgcac------cttctctgatctggcggc-tcagctgcatgtgacccc
                        *                    *  *                         

A0A2K6LV19_BCL2A1-      a----------gaacactattcaatcaagtgatggaaaaggagtttgaag
A0A2K6LV19_BCL2A1-      a----------gaacactattcaatcaagtgatggaaaaggagtttgaag
A0A2K6M5H5_BCL2L10      ---------------------------------------gctctccgaca
A0A2K6KRW9_MCL1-01      atgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaa
A0A2K6KRW9_MCL1-02      atgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaa
A0A2K6KHG1_BCL2-01      cttcaccgcgcggggacgctttgccacggtggtggaggagctcttcaggg
A0A2K6ME72_BCL2L2-      aggctcagcgcagcaacgcttcacccaggtctctgatgaacttttccaag
A0A2K6ME72_BCL2L2-      aggctcagcgcagcaacgcttcacccaggtctctgatgaacttttccaag
                                                                   *      

A0A2K6LV19_BCL2A1-      at------------ggcatcattaactggggaagaattgtaaccat----
A0A2K6LV19_BCL2A1-      at------------ggcatcattaactggggaagaattgtaaccat----
A0A2K6M5H5_BCL2L10      gc---------cccggcccc---acctggggcagggtggtgtcgctggtg
A0A2K6KRW9_MCL1-01      gcggccggctgtcctgcccc---tgctggagttggtcggggaatctggta
A0A2K6KRW9_MCL1-02      gcggccggctgtcctgcccc---tgctggagttggtcggggaatctggta
A0A2K6KHG1_BCL2-01      ac------------ggggtg---aactgggggaggattgtggcctt----
A0A2K6ME72_BCL2L2-      gg------------ggcccc---aactggggccgccttgtagcctt----
A0A2K6ME72_BCL2L2-      gg------------ggcccc---aactggggccgccttgtagcctt----
                                       *         **** *  *    *      *    

A0A2K6LV19_BCL2A1-      ----atttgcatttgaaggtattct---catcaagaaacttctacgacag
A0A2K6LV19_BCL2A1-      ----atttgcatttgaaggtattct---catcaagaaacttctacgacag
A0A2K6M5H5_BCL2L10      ac--cttc------gcggggacgctgc-tggagag-agagccgctggtga
A0A2K6KRW9_MCL1-01      atagctccagtacggatgggtcactac-cctcga----cgccgccgccag
A0A2K6KRW9_MCL1-02      atagctccagtacggatgggtcactac-cctcga----cgccgccgccag
A0A2K6KHG1_BCL2-01      ----ctttgagttcggtggggtcatgtgtgtggag-agcgtcaaccggga
A0A2K6ME72_BCL2L2-      ----ctttgtctttggggctgcactgtgtgctgag-agtgtcaacaagga
A0A2K6ME72_BCL2L2-      ----ctttgtctttggggctgcactgtgtgctgag-agtgtcaacaagga
                             *        *  *      *        *       *        

A0A2K6LV19_BCL2A1-      caaattgccccggatg-------tggatacttataaggagatttcgtatt
A0A2K6LV19_BCL2A1-      caaattgccccggatg-------tggatacttataaggagatttcgtatt
A0A2K6M5H5_BCL2L10      cag------cctggtggaagaagcggagctt--ccagccgcggctgaa--
A0A2K6KRW9_MCL1-01      cag------a--ggaggaggaggacgagttgtaccggcagtcactggaaa
A0A2K6KRW9_MCL1-02      cag------a--ggaggaggaggacgagttgtaccggcagtcactggaaa
A0A2K6KHG1_BCL2-01      gatgtcgcccctggtggacaacatcgccctg-------------tgga--
A0A2K6ME72_BCL2L2-      gatggaaccactggtgggacaagtgcaggag-------------tgga--
A0A2K6ME72_BCL2L2-      gatggaaccactggtgggacaagtgcaggag-------------tgga--
                         *          *  *                             * *  

A0A2K6LV19_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaa---
A0A2K6LV19_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaa---
A0A2K6M5H5_BCL2L10      -------------------ggagcaggagggcgacgtc------------
A0A2K6KRW9_MCL1-01      ttatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaag
A0A2K6KRW9_MCL1-02      ttatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaag
A0A2K6KHG1_BCL2-01      -------tgactgagtacctgaaccggcacctgcacacttggatccagga
A0A2K6ME72_BCL2L2-      -------tggtggcctacctggagacgcggctggctgactggatccacag
A0A2K6ME72_BCL2L2-      -------tggtggcctacctggagacgcggctggctgactggatccacag
                                                        *                 

A0A2K6LV19_BCL2A1-      -----------aacggaggctggggg------------------------
A0A2K6LV19_BCL2A1-      -----------aacggaggct-ggga------------------------
A0A2K6M5H5_BCL2L10      -----------gcccgggactgccagcg-------cctggtggccttgct
A0A2K6KRW9_MCL1-01      ccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacg
A0A2K6KRW9_MCL1-02      ccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacg
A0A2K6KHG1_BCL2-01      t----------aacggaggctgggat------gcctttgtgg--------
A0A2K6ME72_BCL2L2-      c----------agtgggggctgggcg------gagttcacagctctatac
A0A2K6ME72_BCL2L2-      c----------agtgggggctgggagctggaagctatcaaagctcgagtc
                                       * * *                              

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      gagctcg-----cggctcacggggcagcaccgcgcctggcttcagg----
A0A2K6KRW9_MCL1-01      acgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggca
A0A2K6KRW9_MCL1-02      acgggtgggggatggcgtgcagcgcaaccacgagacggctttccaa----
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      ggggacggggccctggaggaggcgcggcgtctgcgggag-----------
A0A2K6ME72_BCL2L2-      agggagatgga---ggaagaagctgagaagctaaaggagctacaga----
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-01      tgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttatct
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-01      cgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggat
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-01      tgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacca
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-01      taaaccaagaaagttgcatcgaaccattagcagaaagtatcacagacgtt
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------aaatgg
A0A2K6LV19_BCL2A1-      --------------------------------------------aaatgg
A0A2K6M5H5_BCL2L10      -------------------------------ctcagggcggctgggatgg
A0A2K6KRW9_MCL1-01      ctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgg
A0A2K6KRW9_MCL1-02      --------------------------------------------ggatgg
A0A2K6KHG1_BCL2-01      ---------------------------------------aactgtacggc
A0A2K6ME72_BCL2L2-      ---------gggaactgggcatcagtgag----------gacagtgctga
A0A2K6ME72_BCL2L2-      -acgaggtagagaagcagatgaatatgagtccacctccaggcaatgctgg
                                                                        * 

A0A2K6LV19_BCL2A1-      c-----------------------------acaatcacatgcctatg-ct
A0A2K6LV19_BCL2A1-      ctttgtaa----------------------agaagtttgaacctaaatct
A0A2K6M5H5_BCL2L10      cttttgtcacttcttc-------aggaccc-----------------cct
A0A2K6KRW9_MCL1-01      gtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatg
A0A2K6KRW9_MCL1-02      gtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatg
A0A2K6KHG1_BCL2-01      cccagca-----------------------tgcggcctctgtttgatttc
A0A2K6ME72_BCL2L2-      c-----------------------------gggggccg------------
A0A2K6ME72_BCL2L2-      cccagtgatcatgtccattgaggagaagatggaggctgatgcccgttcca
                                                                          

A0A2K6LV19_BCL2A1-      agtagagtcagtggcccataggaa--------------------------
A0A2K6LV19_BCL2A1-      ggctggatgacttttctagaagtt--------------------------
A0A2K6M5H5_BCL2L10      ttcc-gctggctttttggagaaaactgct---------------------
A0A2K6KRW9_MCL1-01      tgct-gctggctttt--gcaggtgttgct---------------------
A0A2K6KRW9_MCL1-02      tgct-gctggctttt--gcaggtgttgct---------------------
A0A2K6KHG1_BCL2-01      tcctggctgtctct---gaagactctgct---------------------
A0A2K6ME72_BCL2L2-      -------tggcact---gggggccctggt---------------------
A0A2K6ME72_BCL2L2-      tctatgttggcaat---gtggactatggtgcaacagcagaagagctggaa
                               *                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      gctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtga
                                                                          

A0A2K6LV19_BCL2A1-      -gaagaaaatggcttt----------------------------------
A0A2K6LV19_BCL2A1-      -acaggaaagatctgt----------------------------------
A0A2K6M5H5_BCL2L10      --gatccag--gcttt----------------------------------
A0A2K6KRW9_MCL1-01      --ggagtaggagctgg----------------------------------
A0A2K6KRW9_MCL1-02      --ggagtaggagctgg----------------------------------
A0A2K6KHG1_BCL2-01      -cagttt---ggccct----------------------------------
A0A2K6ME72_BCL2L2-      -aactgtaggggcctt----------------------------------
A0A2K6ME72_BCL2L2-      caaatttagtggccatcccaaagggtttgcgtatatagagttctcagaca
                                    *                                     

A0A2K6LV19_BCL2A1-      ----------gtaa------------------------------------
A0A2K6LV19_BCL2A1-      ----------gaaatgctatctctcctgaagcaatac-------------
A0A2K6M5H5_BCL2L10      --------------------------cctggcatgct-------------
A0A2K6KRW9_MCL1-01      --------------------------tttggcatatc-------------
A0A2K6KRW9_MCL1-02      --------------------------tttggcatatc-------------
A0A2K6KHG1_BCL2-01      -------ggtgggagcttgcatcaccctgggtgccta-------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      aagagtcagtgaggacttccttggccttagatgagtccctatttagagga
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      aggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcac
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6M5H5_BCL2L10      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      aacagaccggggttttccacgagcccgctaccgcgcccggaccaccaact
                                                                          

A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      -------------------------------tgttga-------------
A0A2K6M5H5_BCL2L10      -------------------------------tgttaacaacagccttcgg
A0A2K6KRW9_MCL1-01      -------------------------------taataa-------------
A0A2K6KRW9_MCL1-02      -------------------------------taataa-------------
A0A2K6KHG1_BCL2-01      -------------------------------tctgggccacaag------
A0A2K6ME72_BCL2L2-      -------------------------------ttttgctagcaag------
A0A2K6ME72_BCL2L2-      acaacagttcccgctctcgcttctacagtggttttaacagcaggccccgg
                                                                          

A0A2K6LV19_BCL2A1-      -------------------------
A0A2K6LV19_BCL2A1-      -------------------------
A0A2K6M5H5_BCL2L10      ttacctctggacacgattattatga
A0A2K6KRW9_MCL1-01      ---------gatag-----------
A0A2K6KRW9_MCL1-02      ---------gatagccttactgtaa
A0A2K6KHG1_BCL2-01      ----------------------tga
A0A2K6ME72_BCL2L2-      ----------------------tga
A0A2K6ME72_BCL2L2-      ggtcgcgtctacag-gtcaggatag
                                                 

© 1998-2019