Dataset for CDS BCL2L2 of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6MEE6_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2K6MEE6_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
                        **************************************************

A0A2K6MEE6_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccctg
A0A2K6MEE6_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccctg
                        **************************************************

A0A2K6MEE6_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2K6MEE6_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                        **************************************************

A0A2K6MEE6_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K6MEE6_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
                        **************************************************

A0A2K6MEE6_BCL2L2-      gctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctctg
A0A2K6MEE6_BCL2L2-      gctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctctg
                        **************************************************

A0A2K6MEE6_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A2K6MEE6_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
                        **************************************************

A0A2K6MEE6_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K6MEE6_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
                        **************************************************

A0A2K6MEE6_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K6MEE6_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                        **************************************************

A0A2K6MEE6_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
A0A2K6MEE6_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
                        ********************************* *      *   *** *

A0A2K6MEE6_BCL2L2-      gctcgagtcagggagatgga---ggaagaagctgagaagctaaaggagct
A0A2K6MEE6_BCL2L2-      gctctatacggggacggggccctggaggaggcgcggcgtctgcgggag--
                        **** *  * ****   **    *** ** **   *   **   ****  

A0A2K6MEE6_BCL2L2-      acagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatg
A0A2K6MEE6_BCL2L2-      -------------gggaactgggcatcagtgag----------gacagtg
                                     * ***   *       ****          * ** **

A0A2K6MEE6_BCL2L2-      ctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgt
A0A2K6MEE6_BCL2L2-      ctgac-----------------------------gggggccg--------
                        *** *                             ** *** *        

A0A2K6MEE6_BCL2L2-      tccatctatgttggcaatgtggactatggtgcaacagcagaagagctgga
A0A2K6MEE6_BCL2L2-      -----------tggcactgggggccctggt--------------------
                                   ***** ** ** *  ****                    

A0A2K6MEE6_BCL2L2-      agctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtg
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6MEE6_BCL2L2-      acaaatttagtggccatcccaaagggtttgcgtatatagagttctcagac
A0A2K6MEE6_BCL2L2-      --aactgtaggggcctt---------------------------------
                          ** * *** **** *                                 

A0A2K6MEE6_BCL2L2-      aaagagtcagtgaggacttccttggccttagatgagtccctatttagagg
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6MEE6_BCL2L2-      aaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagca
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6MEE6_BCL2L2-      caacagaccggggttttccacgagcccgctaccgcgcccggaccaccaac
A0A2K6MEE6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6MEE6_BCL2L2-      tacaacagttcccgctctcgcttctacagtggttttaacagcaggccccg
A0A2K6MEE6_BCL2L2-      --------------------------------ttttgctagcaag-----
                                                        ****   **** *     

A0A2K6MEE6_BCL2L2-      gggtcgcgtctacaggtcaggatag
A0A2K6MEE6_BCL2L2-      ----------------------tga
                                              *  

© 1998-2018