Dataset for CDS BCL-2-like of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-04       --------------------------------------------------
P53563_BCL2L1-02       --------------------------------------------------
P53563_BCL2L1-03       --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtct
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      ----------------------------atg-------------------
Q9Z1P3_MCL1-01         ----------------------------atgtttggccttcggagaaacg
G3V977_BCL2A1-01       ----------------------------atg-------------------
Q925A9_BCL2A1-01       ----------------------------atg-------------------
P53563_BCL2L1-01       ----------------------------atg-------------------
P53563_BCL2L1-04       ----------------------------atg-------------------
P53563_BCL2L1-02       ----------------------------atg-------------------
P53563_BCL2L1-03       ----------------------------atg-------------------
O88996_BCL2L2-01       ----------------------------atg-------------------
Q7TS60_BCL2L2-01       gtcatccttgcccctttcagccgcccggatg-------------------
Q7TSN8_BCL2-01         ----------------------------atg-------------------
F1LNV0_BCL2-01         ----------------------------atg-------------------
P49950_BCL2-01         ----------------------------atg-------------------
                                                   ***                   

Q99M66_BCL2L10-01      -ggtgacccgct--------------------------------------
Q9Z1P3_MCL1-01         cggtaatcggcttgaacctgtactgcggcggcgctagcctcggcgcgggc
G3V977_BCL2A1-01       ------------------------------------------aca-----
Q925A9_BCL2A1-01       ------------------------------------------aca-----
P53563_BCL2L1-01       ------------------------------------------tc----tc
P53563_BCL2L1-04       ------------------------------------------tc----tc
P53563_BCL2L1-02       ------------------------------------------tc----tc
P53563_BCL2L1-03       ------------------------------------------tc----tc
O88996_BCL2L2-01       ------------------------------------------gcgacccc
Q7TS60_BCL2L2-01       ------------------------------------------gcgacccc
Q7TSN8_BCL2-01         ------------------------------------------gcg---ca
F1LNV0_BCL2-01         ------------------------------------------gcg---ca
P49950_BCL2-01         ------------------------------------------gcg---ca
                                                                         

Q99M66_BCL2L10-01      ------------gcaggatcgcactagacggctgctgactgacta-----
Q9Z1P3_MCL1-01         ggcggctctccggccgggacgcgcctggcggccgagga--ggccaaggcg
G3V977_BCL2A1-01       ----------------------gactgtgagttcatg------tata---
Q925A9_BCL2A1-01       ----------------------gactgtgagttcatg------tata---
P53563_BCL2L1-01       ag-----------------agcaaccgggagctggtggttgactttc---
P53563_BCL2L1-04       ag-----------------agcaaccgggagctggtggttgactttc---
P53563_BCL2L1-02       ag-----------------agcaaccgggagctggtggttgactttc---
P53563_BCL2L1-03       ag-----------------agcaaccgggagctggtggttgactttc---
O88996_BCL2L2-01       agcctcaacccca------gacacacgggctctagtggctgactttg---
Q7TS60_BCL2L2-01       agcctcaacccca------gacacacgggctctagtggctgactttg---
Q7TSN8_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagtaca---
F1LNV0_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagtaca---
P49950_BCL2-01         agccgggagaacagggtatgataaccgggagatcgtgatgaagtaca---
                                                 *         *             

Q99M66_BCL2L10-01      --------------------------catatt----gttctgcgcac---
Q9Z1P3_MCL1-01         cggcgcgaggggggaggggaggccgctctgct----gcccggcgcgcggg
G3V977_BCL2A1-01       --------------------------tccact------------------
Q925A9_BCL2A1-01       --------------------------tccact------------------
P53563_BCL2L1-01       --------------------------tctcctacaagctctcccagaaag
P53563_BCL2L1-04       --------------------------tctcctacaagctctcccagaaag
P53563_BCL2L1-02       --------------------------tctcctacaagctctcccagaaag
P53563_BCL2L1-03       --------------------------tctcctacaagctctcccagaaag
O88996_BCL2L2-01       --------------------------taggctataagctgaggcagaagg
Q7TS60_BCL2L2-01       --------------------------taggctataagctgaggcagaagg
Q7TSN8_BCL2-01         --------------------------tacattataagctgtcacagaggg
F1LNV0_BCL2-01         --------------------------tccattataagctgtcacagaggg
P49950_BCL2-01         --------------------------tccattataagctgtcacagaggg
                                                      *                  

Q99M66_BCL2L10-01      ----------------------gggcgccgaacacccctgagccactgcc
Q9Z1P3_MCL1-01         tggtcgcccggccgcctccggtgggcgccgaggaccccgacgtcaccgcg
G3V977_BCL2A1-01       ------------------------------------------------cc
Q925A9_BCL2A1-01       ------------------------------------------------cc
P53563_BCL2L1-01       gatacagctggagtcagtttagcgatgtcgaagagaacaggactgaagcc
P53563_BCL2L1-04       gatacagctggagtcagtttagcgatgtcgaagagaacaggactgaagcc
P53563_BCL2L1-02       gatacagctggagtcagtttagcgatgtcgaagagaacaggactgaagcc
P53563_BCL2L1-03       gatacagctggagtcagtttagcgatgtcgaagagaacaggactgaagcc
O88996_BCL2L2-01       gttatgtctgt------------ggagctgg-----------------cc
Q7TS60_BCL2L2-01       gttatgtctgt------------ggagctgg-----------------cc
Q7TSN8_BCL2-01         gctacgagtgg------------gatgctggagatgcggacgcggcgccc
F1LNV0_BCL2-01         gctacgagtgg------------gatactggagatgaagactccgcgccc
P49950_BCL2-01         gctacgagtgg------------gatactggagatgaagactccgcgccc
                                                                       * 

Q99M66_BCL2L10-01      c----------acgtctgttga--------ggcggccttgctgcgctctg
Q9Z1P3_MCL1-01         tcggcagagaggcggctgctcaagtcgcccggcctcctcgccgtgccgcc
G3V977_BCL2A1-01       ctggctga----------------------gaactatcttcagtatgtcc
Q925A9_BCL2A1-01       ctggctga----------------------gaactatcttcagtatgtcc
P53563_BCL2L1-01       ccagaagaaactgaaccagaaa--------gggagacccccagtgccatc
P53563_BCL2L1-04       ccagaagaaactgaaccagaaa--------gggagacccccagtgccatc
P53563_BCL2L1-02       ccagaagaaactgaaccagaaa--------gggagacccccagtgccatc
P53563_BCL2L1-03       ccagaagaaactgaaccagaaa--------gggagacccccagtgccatc
O88996_BCL2L2-01       ctgg--------------------------ggaaggccc-----------
Q7TS60_BCL2L2-01       ctgg--------------------------ggaaggccc-----------
Q7TSN8_BCL2-01         ctgg--------------------------gggctgccc------ccacc
F1LNV0_BCL2-01         ctga--------------------------gggctgccc------ccacc
P49950_BCL2-01         ctga--------------------------gggctgccc------ccacc
                                                     *                   

Q99M66_BCL2L10-01      tgactag----------------------tcagatcc----aacaggagc
Q9Z1P3_MCL1-01         tgaggagatggccgcgtcggccgccgccatcatgtctcccgaggaggagc
G3V977_BCL2A1-01       tgcaggt----------------------acctgcctttg-aatcggctc
Q925A9_BCL2A1-01       tgcaggt----------------------acctgcctttg-aatcggctc
P53563_BCL2L1-01       aatggca----------------------acccatcctggcacctggcgg
P53563_BCL2L1-04       aatggca----------------------acccatcctggcacctggcgg
P53563_BCL2L1-02       aatggca----------------------acccatcctggcacctggcgg
P53563_BCL2L1-03       aatggca----------------------acccatcctggcacctggcgg
O88996_BCL2L2-01       -------------------------------------------------a
Q7TS60_BCL2L2-01       -------------------------------------------------a
Q7TSN8_BCL2-01         cctggca----------------------tcttctccttccagcctgaga
F1LNV0_BCL2-01         cctggca----------------------tcttctccttccagcctgaga
P49950_BCL2-01         cctggca----------------------tcttctccttccagcctgaga
                                                                         

Q99M66_BCL2L10-01      ------------accaggatcttttcaac-------------tccttccg
Q9Z1P3_MCL1-01         tggacggctgtgagccggaggtgctcagcaaacgcccggcggtgctgccc
G3V977_BCL2A1-01       ------------------------caagcaaaacgtccagagtgctacag
Q925A9_BCL2A1-01       ------------------------caagcaaaacgtccagagtgctacag
P53563_BCL2L1-01       ------------------------atagc------cccgcggtga-atgg
P53563_BCL2L1-04       ------------------------atagc------cccgcggtga-atgg
P53563_BCL2L1-02       ------------------------atagc------cccgcggtga-atgg
P53563_BCL2L1-03       ------------------------atagc------cccgcggtga-atgg
O88996_BCL2L2-01       ------------------------gcagccga---cccgc--tgc-acca
Q7TS60_BCL2L2-01       ------------------------gcagccga---cccgc--tgc-acca
Q7TSN8_BCL2-01         ------------------------gcaacccaatgcccgctgtgc-accg
F1LNV0_BCL2-01         ------------------------gcaaccggacgcccgctgtgc-accg
P49950_BCL2-01         ------------------------gcaaccgaacgcccgctgtgc-accg
                                                 * *             *       

Q99M66_BCL2L10-01      cgact----------accagggcaaccg-----cctggagctggtgacac
Q9Z1P3_MCL1-01         ctactggagcgcgtgagcgaggcggctaagagctccggagctgacggctc
G3V977_BCL2A1-01       aga-----------------------------------------------
Q925A9_BCL2A1-01       aga-----------------------------------------------
P53563_BCL2L1-01       agccac-------------tggccacag----------------------
P53563_BCL2L1-04       agccac-------------tggccacag----------------------
P53563_BCL2L1-02       agccac-------------tggccacag----------------------
P53563_BCL2L1-03       agccac-------------tggccacag----------------------
O88996_BCL2L2-01       agccatg-------------------------------------------
Q7TS60_BCL2L2-01       agccatg-------------------------------------------
Q7TSN8_BCL2-01         ggacatggctgccaggacgtctcctctc----------------------
F1LNV0_BCL2-01         agacacggctgccaggacgtcgcctcta----------------------
P49950_BCL2-01         agacacggctgccaggacgtcgcctcta----------------------
                                                                         

Q99M66_BCL2L10-01      ---------------------------------agatggcgg--------
Q9Z1P3_MCL1-01         gctgccctccacgccgccgccgcctgaggaggaagacgacgagctgtacc
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-04       --------------------------------------------------
P53563_BCL2L1-02       --------------------------------------------------
P53563_BCL2L1-03       --------------------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      atgagttgct---------------------------------------c
Q9Z1P3_MCL1-01         accagtcgctggagatcatctcccgctacctgcgggagcaggcgacgggc
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --cagcagtt----------------------------------------
P53563_BCL2L1-04       --cagcagtt----------------------------------------
P53563_BCL2L1-02       --cagcagtt----------------------------------------
P53563_BCL2L1-03       --cagcagtt----------------------------------------
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         --aggcccct----------------------------------------
F1LNV0_BCL2-01         --cggcccct----------------------------------------
P49950_BCL2-01         --cggcccct----------------------------------------
                                                                         

Q99M66_BCL2L10-01      tccaatga--ccaagagttcaactggggccg-------------------
Q9Z1P3_MCL1-01         tccaaggacgcgaagcctctgggcgaggccggcgcagcgggccggagggc
G3V977_BCL2A1-01       ------gttgctttctctgtacaaaagg----------------------
Q925A9_BCL2A1-01       ------gttgctttctctgtacaaaagg----------------------
P53563_BCL2L1-01       -----tg--------gatgcgcgggaggtaatccccatggcagcagtga-
P53563_BCL2L1-04       -----tg--------gatgcgcgggaggtaatccccatggcagcagtga-
P53563_BCL2L1-02       -----tg--------gatgcgcgggaggtaatccccatggcagcagtga-
P53563_BCL2L1-03       -----tg--------gatgcgcgggaggtaatccccatggcagcagtga-
O88996_BCL2L2-01       -----------------cgggc----------------------------
Q7TS60_BCL2L2-01       -----------------cgggc----------------------------
Q7TSN8_BCL2-01         -----cgttgccaccgctgggcctgcgctcagccctgtgccacctgtggt
F1LNV0_BCL2-01         -----tgtcgccaccgctgggcctgcgctcagccctgtgccacctgtggt
P49950_BCL2-01         -----tgtcgccaacgctgggcctgcgctcagccctgtgccacctgtggt
                                                                         

Q99M66_BCL2L10-01      cctggtgatgctcc------------------------------------
Q9Z1P3_MCL1-01         gctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgaga
G3V977_BCL2A1-01       ------------------aagttgaaaagaatctgaa--gccatacttgg
Q925A9_BCL2A1-01       ------------------aagttgaaaagaatctgaa--gccatacttgg
P53563_BCL2L1-01       --agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccgga
P53563_BCL2L1-04       --agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccgga
P53563_BCL2L1-02       --agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccgga
P53563_BCL2L1-03       --agcaagcgctgagagaggctggcgatgagtttgaactgcggtaccgga
O88996_BCL2L2-01       ------------------agctggagacgagtttgagacccgcttccggc
Q7TS60_BCL2L2-01       ------------------agctggagacgagtttgagacccgcttccggc
Q7TSN8_BCL2-01         ccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtc
F1LNV0_BCL2-01         ccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtc
P49950_BCL2-01         ccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtc
                                                                         

Q99M66_BCL2L10-01      tggccttcgtggggacgctaatgaaccaagac----------aggac--t
Q9Z1P3_MCL1-01         cggccttccagggcatgcttcggaaactggacattaaaaacgaggacgat
G3V977_BCL2A1-01       atgacttt---------------------cacgtggaatccatagatact
Q925A9_BCL2A1-01       atgacttt---------------------cacgtggaatccatagatact
P53563_BCL2L1-01       gagcattcagtgatctaacatcccagcttcatataa---ccccagggaca
P53563_BCL2L1-04       gagcattcagtgatctaacatcccagcttcatataa---ccccagggaca
P53563_BCL2L1-02       gagcattcagtgatctaacatcccagcttcatataa---ccccagggaca
P53563_BCL2L1-03       gagcattcagtgatctaacatcccagcttcatataa---ccccagggaca
O88996_BCL2L2-01       gcaccttctctgacctggccgctcagctacacgtga---ccccaggctca
Q7TS60_BCL2L2-01       gcaccttctctgacctggccgctcagctacacgtga---ccccaggctca
Q7TSN8_BCL2-01         gtgacttcgcagagatgtccagtcagctgcacctga---cgcccttcacc
F1LNV0_BCL2-01         gcgactttgcagagatgtccagtcagctgcacctga---cgcccttcacc
P49950_BCL2-01         gcgactttgcagagatgtccagtcagctgcacctga---cgcccttcacc
                            **                       *                   

Q99M66_BCL2L10-01      gttaa---g---------cggaggaggga--------tcaaagaaaccgt
Q9Z1P3_MCL1-01         gttaa---atctttttctcgagtgatgacccatgttttcaaagatggcgt
G3V977_BCL2A1-01       gccagaataatattcaaccaagtgatggaaaaagaatttgaagatggcat
Q925A9_BCL2A1-01       gccagaataatattcaaccaagtgatggaaaaagaatttgaagatggcat
P53563_BCL2L1-01       gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggggt
P53563_BCL2L1-04       gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggggt
P53563_BCL2L1-02       gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggggt
P53563_BCL2L1-03       gcatatcagagctttgaacaggtagtgaatgaactctttcgggatggggt
O88996_BCL2L2-01       gcccagcaacgcttcacccaggtttccgacgaacttttccaagggggccc
Q7TS60_BCL2L2-01       gcccagcaacgcttcacccaggtttccgacgaacttttccaagggggccc
Q7TSN8_BCL2-01         gcgaggggacgctttgccacggtggtggaggaactcttcagggatggggt
F1LNV0_BCL2-01         gcgaggggacgctttgccacggtggtggaggaactcttcagggatggggt
P49950_BCL2-01         gcgaggggacgctttgccacggtggtggaggaactcttcagggatggggt
                       *                                    *    *       

Q99M66_BCL2L10-01      ctcctactggagcgagactgcta--------tctcatagtgagcttgctg
Q9Z1P3_MCL1-01         aacaaactggggcaggattgtgactcttatttcttttggtgcctttgtgg
G3V977_BCL2A1-01       cattaactggggaaggattgtgactatatttgcctttggggg------tg
Q925A9_BCL2A1-01       cattaactggggaaggattgtgactatatttgcctttggggg------tg
P53563_BCL2L1-01       a---aactggggtcgcattgtggccttcttctcctttggcgg------gg
P53563_BCL2L1-04       a---aactggggtcgcattgtggccttcttctcctttggcgg------gg
P53563_BCL2L1-02       a---aactggggtcgcattgtggccttcttctcctttggcgg------gg
P53563_BCL2L1-03       a---aactggggtcgcattgtggccttcttctcctttggcgg------gg
O88996_BCL2L2-01       c---aactggggccgtcttgtggcattctttgtctttggggc------tg
Q7TS60_BCL2L2-01       c---aactggggccgtcttgtggcattctttgtctttggggc------tg
Q7TSN8_BCL2-01         g---aactgggggaggattgtggccttctttgagttcggtgg------gg
F1LNV0_BCL2-01         g---aactgggggaggattgtggccttctttgagttcggtgg------gg
P49950_BCL2-01         g---aactgggggaggattgtggccttctttgagttcggtgg------gg
                            ***** *      **                  * *        *

Q99M66_BCL2L10-01      t---aca----------atcgactcacagg--------------------
Q9Z1P3_MCL1-01         ccaaacacttaaagagcataaaccaagaaa--------------------
G3V977_BCL2A1-01       t--tctcctgaaaaagcttccacaagagcagattgccctggatgtggata
Q925A9_BCL2A1-01       t--tctcctgaaaaagcttccacaagagcagattggcctggatgtggata
P53563_BCL2L1-01       cactgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-a----
P53563_BCL2L1-04       cactgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-a----
P53563_BCL2L1-02       cactgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-a----
P53563_BCL2L1-03       cactgtgcgtggaaagcgtagacaaggagatgcaggtattggtg-a----
O88996_BCL2L2-01       ccctgtgtgctgagagtgtcaacaaagaaatggagccattggtg-ggaca
Q7TS60_BCL2L2-01       ccctgtgtgctgagagtgtcaacaaagaaatggagccattggtg-ggaca
Q7TSN8_BCL2-01         tcatgtgtgtggagagcgtcaacagggagatgtcacccctggtg-g----
F1LNV0_BCL2-01         tcatgtgtgtggagagcgtcaacagggagatgtcacccctggtg-g----
P49950_BCL2-01         tcatgtgtgtggggagcgtcaacagggagatgtcacccctggtg-g----
                                         *  **                           

Q99M66_BCL2L10-01      ---acggc---atcgctc--------------------------------
Q9Z1P3_MCL1-01         ---gctgc---atcgaacctttagcagaaagtatcacagacgttcttgta
G3V977_BCL2A1-01       cttacaagcaagtttccagttttgtggcggaattcataatgaataacaca
Q925A9_BCL2A1-01       cttacaagcaagtttccagttttgtggcggaattcataatgaataacaca
P53563_BCL2L1-01       ---gtcgg---attgcaagttggatggccacctacctgaatgaccaccta
P53563_BCL2L1-04       ---gtcgg---attgcaagttggatggccacctacctgaatgaccaccta
P53563_BCL2L1-02       ---gtcgg---attgcaagttggatggccacctacctgaatgaccaccta
P53563_BCL2L1-03       ---gtcgg---attgcaagttggatggccacctacctgaatgaccaccta
O88996_BCL2L2-01       agtgcagg---at-------tggatggtgacctacctggagacacgcttg
Q7TS60_BCL2L2-01       agtgcagg---at-------tggatggtgacctacctggagacacgcttg
Q7TSN8_BCL2-01         ---acaac---atcgccctgtggatgactgagtacctgaaccggcatctg
F1LNV0_BCL2-01         ---acaac---atcgctctgtggatgactgagtacctgaaccggcatctg
P49950_BCL2-01         ---acaac---atcgctctgtggatgactgagtacctgaaccggcatctg
                                   *                                     

Q99M66_BCL2L10-01      --------------ctggctggaggctcacggtggctgggatg-------
Q9Z1P3_MCL1-01         aggacgaagcgggactggcttgtgaaacaaagaggctgggatg-------
G3V977_BCL2A1-01       ggaga---------atggatacagcagaatggaggctgggaag-------
Q925A9_BCL2A1-01       ggaga---------atggatacagcagaatggaggctgggaag-------
P53563_BCL2L1-01       gagcc---------ttggatccaggagaacggcggctgggaca-------
P53563_BCL2L1-04       gagcc---------ttggatccaggagaacggcggctgggtaagaaccac
P53563_BCL2L1-02       gagcc---------ttggatccaggagaacggcggctgggtaagaaccac
P53563_BCL2L1-03       gagcc---------ttggatccaggagaacggcggctgggtaagaaccac
O88996_BCL2L2-01       gctga---------ctggatccacagcagtgggggctgggcgg-------
Q7TS60_BCL2L2-01       gctga---------ctggatccacagcagtgggggctgggcgg-------
Q7TSN8_BCL2-01         cacac---------ctggatccaggataacggaggctgggatg-------
F1LNV0_BCL2-01         cacac---------ctggatccaggataacggaggctgggatg-------
P49950_BCL2-01         cacac---------ctggatccaggataacggaggctgggatg-------
                                      *** *           * *******          

Q99M66_BCL2L10-01      -----------------gcttttgccaattcttc------aagaacccct
Q9Z1P3_MCL1-01         -----------------ggtttgtggagttcttccacgtacaggacc---
G3V977_BCL2A1-01       ----------------------atggcttcacaaagaagtttgaacc---
Q925A9_BCL2A1-01       ----------------------atggcttcacaaagaagtttgaacc---
P53563_BCL2L1-01       -----------------cttttgtggatctctacgggaacaatgcag---
P53563_BCL2L1-04       gccccttgtgtgtccgccccttgtgtgtctct------------cct---
P53563_BCL2L1-02       gccccttgtgtgtccgccccttgtgtgtctct------------cct---
P53563_BCL2L1-03       gccccttgtgtgtccgccccttgtgtgtctct------------cct---
O88996_BCL2L2-01       -----------------agttcacagctctatacggggacggggccc---
Q7TS60_BCL2L2-01       -----------------agttcacagctctatacggggacggggccc---
Q7TSN8_BCL2-01         -----------------cctttgtggaactatat--------ggccc---
F1LNV0_BCL2-01         -----------------cctttgtggaactatat--------ggccc---
P49950_BCL2-01         -----------------cctttgtggaactatat--------ggccc---
                                                                         

Q99M66_BCL2L10-01      tacc----acccggcttctg-----------------------gagaaga
Q9Z1P3_MCL1-01         taga----aggcggcatc--------------------------agaaat
G3V977_BCL2A1-01       taaa--------------------------tctggctggct---------
Q925A9_BCL2A1-01       taaa--------------------------tctggctggct---------
P53563_BCL2L1-01       cagccgagagccg----------gaaaggccaggagcgtttcaaccgctg
P53563_BCL2L1-04       ctgtggagatccc----------taactgcc-----ctttt-------tg
P53563_BCL2L1-02       ctgtggagatccc----------taactgcc-----ctttt-------tg
P53563_BCL2L1-03       ctgtggagatccc----------taactgcc-----ctttt-------tg
O88996_BCL2L2-01       tggaggaggcacggcgtctgcgggaggggaactgggcatcagtgaggaca
Q7TS60_BCL2L2-01       tggaggaggcacggcgtctgcgggaggggaactgggcatcagtgaggaca
Q7TSN8_BCL2-01         cagc----atgcgacctctgtttgatttctcctggctgtctctgaagacc
F1LNV0_BCL2-01         cagc----atgcgacctctgtttgatttctcctggctgtctctgaagacg
P49950_BCL2-01         cagc----atgcgacctctgtttgatttctcctggctgtctctgaagacg
                                                                         

Q99M66_BCL2L10-01      ttgctgatccgggctattctgtcctgtttcttt-gca-----acggcc-a
Q9Z1P3_MCL1-01         gtgctg---ctggcttttgcgg-gtgttgctggagta-----ggggctgg
G3V977_BCL2A1-01       -----------gacttttctgcagatgacagggaagatctgggaaatgct
Q925A9_BCL2A1-01       -----------gacttttctgcagatgacagggaagatctgggaaatgct
P53563_BCL2L1-01       gt-tcctgacgggcatgactgtggctggtgtagtt-------------ct
P53563_BCL2L1-04       gt-ctc---ctggcatggttgttgaagatatcgattattcaggagacatt
P53563_BCL2L1-02       gt-ctc---ctggcatggttgttgaagatatcgattattcaggagacatt
P53563_BCL2L1-03       gt-ctc---ctggcatggttgttgaagatatcgattattcaggagacatt
O88996_BCL2L2-01       gtgctgacgggggctgtggcactgggggccctggtaactgtaggggcctt
Q7TS60_BCL2L2-01       gtgctgacgggggctgtggcactgggggccctggtaactgtaggggcctt
Q7TSN8_BCL2-01         ctgctcagcctggccctgg---tcggggcctgcatcactctgggtgcata
F1LNV0_BCL2-01         ctgctcagcctggccctgg---tgggggcctgcatcactctgggtgcata
P49950_BCL2-01         ctgctcagcctggccctgg---tgggggcctgcatcactctgggtgcata
                                  * *                                    

Q99M66_BCL2L10-01      tctttt-----------atatctggaaatgtttataa-------------
Q9Z1P3_MCL1-01         tctggc-----------atatctaataagg----tag-------------
G3V977_BCL2A1-01       ctttct------------cctcaagcaacactactga-------------
Q925A9_BCL2A1-01       ctttct------------cctcaagcaacactactga-------------
P53563_BCL2L1-01       gctgggctcactcttcagtcggaagtga----------------------
P53563_BCL2L1-04       cctggc-tcactttaa----------------------------------
P53563_BCL2L1-02       cctggcttcactttaataccaggggttaactttgggaatattgatgaccc
P53563_BCL2L1-03       cctggcttcactttaataccaggggttaactttgggaatattgatgaccc
O88996_BCL2L2-01       ttttgc------------tagcaagtga----------------------
Q7TS60_BCL2L2-01       ttttgc------------tagcaagtga----------------------
Q7TSN8_BCL2-01         cctggg------------ccacaagtga----------------------
F1LNV0_BCL2-01         cctggg------------ccacaagtga----------------------
P49950_BCL2-01         cctggg------------ccacaagtga----------------------
                         *                                               

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-04       --------------------------------------------------
P53563_BCL2L1-02       tgtttttaaggaacctgtatttttcattctggctacccttgtggccccgc
P53563_BCL2L1-03       tgtttttaaggaacctgtatttttcattctggctacccttgtggccccgc
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      --------------------------------------------------
Q9Z1P3_MCL1-01         --------------------------------------------------
G3V977_BCL2A1-01       --------------------------------------------------
Q925A9_BCL2A1-01       --------------------------------------------------
P53563_BCL2L1-01       --------------------------------------------------
P53563_BCL2L1-04       --------------------------------------------------
P53563_BCL2L1-02       agtttcatagttttgttccaatttctcggcaaagaaaaacagcctgtgtg
P53563_BCL2L1-03       agtttcatagttttgttccaatttctcggcaaagaaaaacagcctgtgtg
O88996_BCL2L2-01       --------------------------------------------------
Q7TS60_BCL2L2-01       --------------------------------------------------
Q7TSN8_BCL2-01         --------------------------------------------------
F1LNV0_BCL2-01         --------------------------------------------------
P49950_BCL2-01         --------------------------------------------------
                                                                         

Q99M66_BCL2L10-01      ---------------------
Q9Z1P3_MCL1-01         ---------------------
G3V977_BCL2A1-01       ---------------------
Q925A9_BCL2A1-01       ---------------------
P53563_BCL2L1-01       ---------------------
P53563_BCL2L1-04       ---------------------
P53563_BCL2L1-02       tttacttggcttaaaacctag
P53563_BCL2L1-03       tttacttggcttaaaacctag
O88996_BCL2L2-01       ---------------------
Q7TS60_BCL2L2-01       ---------------------
Q7TSN8_BCL2-01         ---------------------
F1LNV0_BCL2-01         ---------------------
P49950_BCL2-01         ---------------------
                                            

© 1998-2018