Dataset for CDS BCL2L1 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q7TS62_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q7TS62_BCL2L1-03      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q7TS62_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q7TS62_BCL2L1-04      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

Q7TS62_BCL2L1-01      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
Q7TS62_BCL2L1-03      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
Q7TS62_BCL2L1-02      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
Q7TS62_BCL2L1-04      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
                      **************************************************

Q7TS62_BCL2L1-01      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
Q7TS62_BCL2L1-03      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
Q7TS62_BCL2L1-02      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
Q7TS62_BCL2L1-04      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
                      **************************************************

Q7TS62_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
Q7TS62_BCL2L1-03      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
Q7TS62_BCL2L1-02      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
Q7TS62_BCL2L1-04      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
                      **************************************************

Q7TS62_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
Q7TS62_BCL2L1-03      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
Q7TS62_BCL2L1-02      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
Q7TS62_BCL2L1-04      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
                      **************************************************

Q7TS62_BCL2L1-01      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
Q7TS62_BCL2L1-03      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
Q7TS62_BCL2L1-02      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
Q7TS62_BCL2L1-04      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
                      **************************************************

Q7TS62_BCL2L1-01      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
Q7TS62_BCL2L1-03      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
Q7TS62_BCL2L1-02      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
Q7TS62_BCL2L1-04      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
                      **************************************************

Q7TS62_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
Q7TS62_BCL2L1-03      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
Q7TS62_BCL2L1-02      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
Q7TS62_BCL2L1-04      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
                      **************************************************

Q7TS62_BCL2L1-01      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
Q7TS62_BCL2L1-03      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
Q7TS62_BCL2L1-02      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
Q7TS62_BCL2L1-04      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
                      **************************************************

Q7TS62_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q7TS62_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q7TS62_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q7TS62_BCL2L1-04      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
                      **************************************************

Q7TS62_BCL2L1-01      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
Q7TS62_BCL2L1-03      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
Q7TS62_BCL2L1-02      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
Q7TS62_BCL2L1-04      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
                      **************************************************

Q7TS62_BCL2L1-01      agaacggcggctgggaca------------------------cttttgtg
Q7TS62_BCL2L1-03      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
Q7TS62_BCL2L1-02      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
Q7TS62_BCL2L1-04      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
                      ***************  *                        *  *****

Q7TS62_BCL2L1-01      gatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcg
Q7TS62_BCL2L1-03      tgtctct------------cctctgtggagatccctaactgcc-----ct
Q7TS62_BCL2L1-02      tgtctct------------cctctgtggagatccctaactgcc-----ct
Q7TS62_BCL2L1-04      tgtctct------------cctctgtggagatccctaactgcc-----ct
                        *****            *  * *  **** **  **  ***     * 

Q7TS62_BCL2L1-01      tttcaaccgctggttcctgacgggcatgactgtggctggtgtagtt----
Q7TS62_BCL2L1-03      ttt-------tggtctc---ctggcatggttgttgaagatatcgattatt
Q7TS62_BCL2L1-02      ttt-------tggtctc---ctggcatggttgttgaagatatcgattatt
Q7TS62_BCL2L1-04      ttt-------tggtctc---ctggcatggttgttgaagatatcgattatt
                      ***       ****  *   * ******  *** *  * * * * *    

Q7TS62_BCL2L1-01      ---------ctgctgggctcactcttcagtcggaagtga-----------
Q7TS62_BCL2L1-03      caggagacattcctggcttcactttaataccaggggttaactttgggaat
Q7TS62_BCL2L1-02      caggagacattcctggcttcactttaataccaggggttaactttgggaat
Q7TS62_BCL2L1-04      caggagacattcctggc-tcactttaa-----------------------
                                * ****  ***** *                         

Q7TS62_BCL2L1-01      --------------------------------------------------
Q7TS62_BCL2L1-03      attgatgaccctgtttttaaggaacctgtatttttcattctggctaccct
Q7TS62_BCL2L1-02      attgatgaccctgtttttaaggaacctgtatttttcattctggctaccct
Q7TS62_BCL2L1-04      --------------------------------------------------
                                                                        

Q7TS62_BCL2L1-01      --------------------------------------------------
Q7TS62_BCL2L1-03      tgtggccccgcagtttcatagttttgttccaatttctcggcaaagaaaaa
Q7TS62_BCL2L1-02      tgtggccccgcagtttcatagttttgttccaatttctcggcaaagaaaaa
Q7TS62_BCL2L1-04      --------------------------------------------------
                                                                        

Q7TS62_BCL2L1-01      --------------------------------
Q7TS62_BCL2L1-03      cagcctgtgtgtttacttggcttaaaacctag
Q7TS62_BCL2L1-02      cagcctgtgtgtttacttggcttaaaacctag
Q7TS62_BCL2L1-04      --------------------------------
                                                      

© 1998-2018