Dataset for CDS BCL2L1 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P53563_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
P53563_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
P53563_BCL2L1-03      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
P53563_BCL2L1-04      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

P53563_BCL2L1-01      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
P53563_BCL2L1-02      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
P53563_BCL2L1-03      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
P53563_BCL2L1-04      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
                      **************************************************

P53563_BCL2L1-01      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
P53563_BCL2L1-02      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
P53563_BCL2L1-03      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
P53563_BCL2L1-04      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
                      **************************************************

P53563_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
P53563_BCL2L1-02      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
P53563_BCL2L1-03      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
P53563_BCL2L1-04      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
                      **************************************************

P53563_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
P53563_BCL2L1-02      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
P53563_BCL2L1-03      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
P53563_BCL2L1-04      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
                      **************************************************

P53563_BCL2L1-01      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
P53563_BCL2L1-02      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
P53563_BCL2L1-03      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
P53563_BCL2L1-04      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
                      **************************************************

P53563_BCL2L1-01      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
P53563_BCL2L1-02      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
P53563_BCL2L1-03      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
P53563_BCL2L1-04      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
                      **************************************************

P53563_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
P53563_BCL2L1-02      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
P53563_BCL2L1-03      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
P53563_BCL2L1-04      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
                      **************************************************

P53563_BCL2L1-01      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
P53563_BCL2L1-02      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
P53563_BCL2L1-03      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
P53563_BCL2L1-04      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
                      **************************************************

P53563_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
P53563_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
P53563_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
P53563_BCL2L1-04      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
                      **************************************************

P53563_BCL2L1-01      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
P53563_BCL2L1-02      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
P53563_BCL2L1-03      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
P53563_BCL2L1-04      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
                      **************************************************

P53563_BCL2L1-01      agaacggcggctgggaca------------------------cttttgtg
P53563_BCL2L1-02      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
P53563_BCL2L1-03      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
P53563_BCL2L1-04      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
                      ***************  *                        *  *****

P53563_BCL2L1-01      gatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcg
P53563_BCL2L1-02      tgtctct------------cctctgtggagatccctaactgcc-----ct
P53563_BCL2L1-03      tgtctct------------cctctgtggagatccctaactgcc-----ct
P53563_BCL2L1-04      tgtctct------------cctctgtggagatccctaactgcc-----ct
                        *****            *  * *  **** **  **  ***     * 

P53563_BCL2L1-01      tttcaaccgctggttcctgacgggcatgactgtggctggtgtagtt----
P53563_BCL2L1-02      ttt-------tggtctc---ctggcatggttgttgaagatatcgattatt
P53563_BCL2L1-03      ttt-------tggtctc---ctggcatggttgttgaagatatcgattatt
P53563_BCL2L1-04      ttt-------tggtctc---ctggcatggttgttgaagatatcgattatt
                      ***       ****  *   * ******  *** *  * * * * *    

P53563_BCL2L1-01      ---------ctgctgggctcactcttcagtcggaagtga-----------
P53563_BCL2L1-02      caggagacattcctggcttcactttaataccaggggttaactttgggaat
P53563_BCL2L1-03      caggagacattcctggcttcactttaataccaggggttaactttgggaat
P53563_BCL2L1-04      caggagacattcctggc-tcactttaa-----------------------
                                * ****  ***** *                         

P53563_BCL2L1-01      --------------------------------------------------
P53563_BCL2L1-02      attgatgaccctgtttttaaggaacctgtatttttcattctggctaccct
P53563_BCL2L1-03      attgatgaccctgtttttaaggaacctgtatttttcattctggctaccct
P53563_BCL2L1-04      --------------------------------------------------
                                                                        

P53563_BCL2L1-01      --------------------------------------------------
P53563_BCL2L1-02      tgtggccccgcagtttcatagttttgttccaatttctcggcaaagaaaaa
P53563_BCL2L1-03      tgtggccccgcagtttcatagttttgttccaatttctcggcaaagaaaaa
P53563_BCL2L1-04      --------------------------------------------------
                                                                        

P53563_BCL2L1-01      --------------------------------
P53563_BCL2L1-02      cagcctgtgtgtttacttggcttaaaacctag
P53563_BCL2L1-03      cagcctgtgtgtttacttggcttaaaacctag
P53563_BCL2L1-04      --------------------------------
                                                      

© 1998-2019