Dataset for CDS BCL2A1 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3V977_BCL2A1-01      atgacagactgtgagttcatgtatatccactccctggctgagaactatct
Q925A9_BCL2A1-01      atgacagactgtgagttcatgtatatccactccctggctgagaactatct
                      **************************************************

G3V977_BCL2A1-01      tcagtatgtcctgcaggtacctgcctttgaatcggctccaagcaaaacgt
Q925A9_BCL2A1-01      tcagtatgtcctgcaggtacctgcctttgaatcggctccaagcaaaacgt
                      **************************************************

G3V977_BCL2A1-01      ccagagtgctacagagagttgctttctctgtacaaaaggaagttgaaaag
Q925A9_BCL2A1-01      ccagagtgctacagagagttgctttctctgtacaaaaggaagttgaaaag
                      **************************************************

G3V977_BCL2A1-01      aatctgaagccatacttggatgactttcacgtggaatccatagatactgc
Q925A9_BCL2A1-01      aatctgaagccatacttggatgactttcacgtggaatccatagatactgc
                      **************************************************

G3V977_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagaatttgaagatggcatca
Q925A9_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagaatttgaagatggcatca
                      **************************************************

G3V977_BCL2A1-01      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctg
Q925A9_BCL2A1-01      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctg
                      **************************************************

G3V977_BCL2A1-01      aaaaagcttccacaagagcagattgccctggatgtggatacttacaagca
Q925A9_BCL2A1-01      aaaaagcttccacaagagcagattggcctggatgtggatacttacaagca
                      ************************* ************************

G3V977_BCL2A1-01      agtttccagttttgtggcggaattcataatgaataacacaggagaatgga
Q925A9_BCL2A1-01      agtttccagttttgtggcggaattcataatgaataacacaggagaatgga
                      **************************************************

G3V977_BCL2A1-01      tacagcagaatggaggctgggaagatggcttcacaaagaagtttgaacct
Q925A9_BCL2A1-01      tacagcagaatggaggctgggaagatggcttcacaaagaagtttgaacct
                      **************************************************

G3V977_BCL2A1-01      aaatctggctggctgacttttctgcagatgacagggaagatctgggaaat
Q925A9_BCL2A1-01      aaatctggctggctgacttttctgcagatgacagggaagatctgggaaat
                      **************************************************

G3V977_BCL2A1-01      gctctttctcctcaagcaacactactga
Q925A9_BCL2A1-01      gctctttctcctcaagcaacactactga
                      ****************************

© 1998-2018