Dataset for CDS BCL-2 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q7TSN8_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacat
F1LNV0_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccat
P49950_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccat
                    ******************************************************** ***

Q7TSN8_BCL2-01      tataagctgtcacagaggggctacgagtgggatgctggagatgcggacgcggcgcccctg
F1LNV0_BCL2-01      tataagctgtcacagaggggctacgagtgggatactggagatgaagactccgcgcccctg
P49950_BCL2-01      tataagctgtcacagaggggctacgagtgggatactggagatgaagactccgcgcccctg
                    ********************************* *********  *** * *********

Q7TSN8_BCL2-01      ggggctgcccccacccctggcatcttctccttccagcctgagagcaacccaatgcccgct
F1LNV0_BCL2-01      agggctgcccccacccctggcatcttctccttccagcctgagagcaaccggacgcccgct
P49950_BCL2-01      agggctgcccccacccctggcatcttctccttccagcctgagagcaaccgaacgcccgct
                     ************************************************  * *******

Q7TSN8_BCL2-01      gtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
F1LNV0_BCL2-01      gtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaccgctggg
P49950_BCL2-01      gtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaacgctggg
                    ******** **** *************** *****  ******* ** **** *******

Q7TSN8_BCL2-01      cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgac
F1LNV0_BCL2-01      cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgac
P49950_BCL2-01      cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgac
                    ******************************** ***************************

Q7TSN8_BCL2-01      ttctctcgtcgctaccgtcgtgacttcgcagagatgtccagtcagctgcacctgacgccc
F1LNV0_BCL2-01      ttctctcgtcgctaccgtcgcgactttgcagagatgtccagtcagctgcacctgacgccc
P49950_BCL2-01      ttctctcgtcgctaccgtcgcgactttgcagagatgtccagtcagctgcacctgacgccc
                    ******************** ***** *********************************

Q7TSN8_BCL2-01      ttcaccgcgaggggacgctttgccacggtggtggaggaactcttcagggatggggtgaac
F1LNV0_BCL2-01      ttcaccgcgaggggacgctttgccacggtggtggaggaactcttcagggatggggtgaac
P49950_BCL2-01      ttcaccgcgaggggacgctttgccacggtggtggaggaactcttcagggatggggtgaac
                    ************************************************************

Q7TSN8_BCL2-01      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
F1LNV0_BCL2-01      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
P49950_BCL2-01      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggggagcgtcaac
                    ************************************************* **********

Q7TSN8_BCL2-01      agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccgg
F1LNV0_BCL2-01      agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccgg
P49950_BCL2-01      agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccgg
                    ******************************** ***************************

Q7TSN8_BCL2-01      catctgcacacctggatccaggataacggaggctgggatgcctttgtggaactatatggc
F1LNV0_BCL2-01      catctgcacacctggatccaggataacggaggctgggatgcctttgtggaactatatggc
P49950_BCL2-01      catctgcacacctggatccaggataacggaggctgggatgcctttgtggaactatatggc
                    ************************************************************

Q7TSN8_BCL2-01      cccagcatgcgacctctgtttgatttctcctggctgtctctgaagaccctgctcagcctg
F1LNV0_BCL2-01      cccagcatgcgacctctgtttgatttctcctggctgtctctgaagacgctgctcagcctg
P49950_BCL2-01      cccagcatgcgacctctgtttgatttctcctggctgtctctgaagacgctgctcagcctg
                    *********************************************** ************

Q7TSN8_BCL2-01      gccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
F1LNV0_BCL2-01      gccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
P49950_BCL2-01      gccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
                    ******** ******************************************

© 1998-2018