Dataset for CDS BCL2L2 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6GWN0_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A2K6GWN0_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
                        **************************************************

A0A2K6GWN0_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggcccgg
A0A2K6GWN0_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggcccgg
                        **************************************************

A0A2K6GWN0_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2K6GWN0_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                        **************************************************

A0A2K6GWN0_BCL2L2-      gatgagtttgagacccgcttccggcgtaccttctctgatctggcggctca
A0A2K6GWN0_BCL2L2-      gatgagtttgagacccgcttccggcgtaccttctctgatctggcggctca
                        **************************************************

A0A2K6GWN0_BCL2L2-      gctgcatgtgacccccggctcagcccagcagcgcttcacccaggtctccg
A0A2K6GWN0_BCL2L2-      gctgcatgtgacccccggctcagcccagcagcgcttcacccaggtctccg
                        **************************************************

A0A2K6GWN0_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtggccttcttc
A0A2K6GWN0_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtggccttcttc
                        **************************************************

A0A2K6GWN0_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggagcc
A0A2K6GWN0_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggagcc
                        **************************************************

A0A2K6GWN0_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
A0A2K6GWN0_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
                        **************************************************

A0A2K6GWN0_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
A0A2K6GWN0_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagccatcaaa
                        ********************************* *      *   *** *

A0A2K6GWN0_BCL2L2-      gctctatacggggacggggccctggaggagg-------------------
A0A2K6GWN0_BCL2L2-      gctc------gggtcagggagatggaggaagaagctgagaagttaaaaga
                        ****      *** * ***   ******* *                   

A0A2K6GWN0_BCL2L2-      ---------cgcgg------------------------------------
A0A2K6GWN0_BCL2L2-      gctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca
                                 ** **                                    

A0A2K6GWN0_BCL2L2-      ------------------cgtctgcgggaggggaactggg----------
A0A2K6GWN0_BCL2L2-      atgctggtccagtgatcatgtccattgaagagaaaatggaggctgatgcc
                                           ***    * ** * ** ***           

A0A2K6GWN0_BCL2L2-      -----catcagtgaggacagtgctga--------caggggccgtggcact
A0A2K6GWN0_BCL2L2-      cgttccatctatgttggcaatgtggactatggtgcaacagcagaagagct
                             ****  **  * ** **  **        **   ** *  *  **

A0A2K6GWN0_BCL2L2-      gggggccc------------------------------------------
A0A2K6GWN0_BCL2L2-      ggaagctcactttcatggttgtggttcagtcaaccgtgttaccatactgt
                        **  ** *                                          

A0A2K6GWN0_BCL2L2-      -tggtaactgtaggggcc--------------------------------
A0A2K6GWN0_BCL2L2-      gtgacaaatttagtggccatcccaaagggtttgcatatatagagttctca
                         **  ** * *** ****                                

A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2K6GWN0_BCL2L2-      gacaaagagtcagtgaggacttccctggccttagatgagtccctgtttag
                                                                          

A0A2K6GWN0_BCL2L2-      -----------------------------------------tttttcgct
A0A2K6GWN0_BCL2L2-      aggaagacaaatcaaggtaagcctgtgctttccattgtacatcctttact
                                                                 *  **  **

A0A2K6GWN0_BCL2L2-      agcaagtga-----------------------------------------
A0A2K6GWN0_BCL2L2-      ctcaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagac
                          ** ****                                         

A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2K6GWN0_BCL2L2-      cggggtttcccacgagcccgctaccgtgcccggactaccaactacaacag
                                                                          

A0A2K6GWN0_BCL2L2-      --------------------------------------------------
A0A2K6GWN0_BCL2L2-      ttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcg
                                                                          

A0A2K6GWN0_BCL2L2-      -----------------------------------------------
A0A2K6GWN0_BCL2L2-      tctacaggggccgggctagagcgacatcatggtattccccttactaa
                                                                       

© 1998-2018