Dataset for CDS BCL-2-like of organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2NNZ9_BCL2A1-01        atgac------------------------agactgtgaatttgggtata-
A0A2J8VIH3_BCL2L1-      atgtctcagag------------------caaccgggagctggtggttga
H2NWH5_BCL2-01          atggcgcacgctgggacaacagggtacgataaccgggagatagtcgatga
H2N5Y9_MCL1-01          atgtt------------------------cggcctcaaaagaaacgcggt
H2NN92_BCL2L10-01       atggt------------------------tgacc-------agttgcgg-
                        ***                             *                 

H2NNZ9_BCL2A1-01        --------tttacaggctagctcagga------ctatctg----------
A0A2J8VIH3_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
H2NWH5_BCL2-01          aancatccattataagttgtcgcagaggggctacgagtgg----------
H2N5Y9_MCL1-01          aatcggactcaacct-ctactgtgggggggc--cggcttg----------
H2NN92_BCL2L10-01       gagcgcact--atca-c-----------ggc--cgacct-----------
                                   *                     *                

H2NNZ9_BCL2A1-01        -------------------cagtacgtcct--------------------
A0A2J8VIH3_BCL2L1-      gtgatgtggaagagaacaggactgaggccccagaagggactgaatcg---
H2NWH5_BCL2-01          --gatgcgggagatgtgggcgccgcgcccccgg--gggccgccaccg---
H2N5Y9_MCL1-01          --ggtgctggcagcggcggcgccacccctccgggagggcggcttttggct
H2NN92_BCL2L10-01       ---------gctgagggagcg-cacc---------gagcggctgctggcc
                                                                          

H2NNZ9_BCL2A1-01        ------acagataccacaacct----------------------------
A0A2J8VIH3_BCL2L1-      ---gagatggagacc----ccc----------------------------
H2NWH5_BCL2-01          ---cacccggcatcttctcctc----------------------------
H2N5Y9_MCL1-01          acggagaaggaggcctcggcccggcgagagatagggggaggggaggccgg
H2NN92_BCL2L10-01       gactacctggggtgctgcgccc------------------gggaacccgg
                                 *         *                              

H2NNZ9_BCL2A1-01        ----------------ggatcaggtccaagcaaagcgtccagagtactac
A0A2J8VIH3_BCL2L1-      ----------------agtgccatcaatggcaacccatcctggcacctgg
H2NWH5_BCL2-01          ----------------ccagcccgggcacacgcctcatccagccgcatcc
H2N5Y9_MCL1-01          cgcggtgattggcggaagcgccggcgcaagccccccgtctaccctcacgc
H2NN92_BCL2L10-01       cacccc----------agagccgacgc--------------cgcccacgc
                                            *                             

H2NNZ9_BCL2A1-01        aaaa------------------ggttgcgttct-----------------
A0A2J8VIH3_BCL2L1-      cggacagccccgcggtgaatggagccactggccacagcagcagtttggat
H2NWH5_BCL2-01          cgggacccggccaggacctcgccgctgccgacc------cc---------
H2N5Y9_MCL1-01          cagactcccg-gagggtcgcgcggccgccgcccattggcgc---------
H2NN92_BCL2L10-01       c------------------cgaggccgccgtgc-tgcgctc---------
                                               *   *                      

H2NNZ9_BCL2A1-01        ----------cagtccaaaaagaagtggaaaa------------------
A0A2J8VIH3_BCL2L1-      gcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggc
H2NWH5_BCL2-01          --------ggctgcccctggcgccgccgtggggcctgcgctcagcccggt
H2N5Y9_MCL1-01          --------cgaggtccccgacgtcaccgcgacccccgcg---aggctgtt
H2NN92_BCL2L10-01       --------cgcggccgcc-aggttacggcagctccacc-----ggtcctt
                                      *      *     *                      

H2NNZ9_BCL2A1-01        --------------------gaatctgaagccatgcttggacaac-----
A0A2J8VIH3_BCL2L1-      aggcgacg-------agtttgaac---------tgcggtaccggcgg-gc
H2NWH5_BCL2-01          gccacctg------tggtccacct--gaccctccgccaggccgg------
H2N5Y9_MCL1-01          tttcttcg-------cgcccaccc-----gccgcgcggcgccgcttgagg
H2NN92_BCL2L10-01       cttctccgcctacctcggctaccccgggaaccgcgtcgaactggtggcgc
                                                          *               

H2NNZ9_BCL2A1-01        -----gttaatgttgtgtccgtagacactgccagaacact----------
A0A2J8VIH3_BCL2L1-      attcagtga----cctgacatcc--cagctccacatcacc----------
H2NWH5_BCL2-01          ---cgacgacttctcccgccgctaccgccgcgacttcgccgagatgtcca
H2N5Y9_MCL1-01          agatggaag---ccccggccgccgacgccatcatgtcgcc----------
H2NN92_BCL2L10-01       tgatggcggattccgtgctctccgacagcccca----gcc----------
                                                 *      *     *           

H2NNZ9_BCL2A1-01        ------------------------------attcaaccaagta-------
A0A2J8VIH3_BCL2L1-      -cca---gggacagcatatcagagctttgaa------caggta-------
H2NWH5_BCL2-01          gccagctgcacctg-------acgcccttca-ccgcgcgggga----cgc
H2N5Y9_MCL1-01          -cgaagaggagctggacgggtacgagccggagcctctcgggaagcggccg
H2NN92_BCL2L10-01       -ccacctggggcagagtggtgacgctcgtgaccttcgcaggga-------
                                                      *      *  * *       

H2NNZ9_BCL2A1-01        ------------atggaaaaggagtttgaagatg-gcatcatta-actgg
A0A2J8VIH3_BCL2L1-      ------------gtgaatgaactcttccgggatg-gggtaa----actgg
H2NWH5_BCL2-01          tttgccacggtggtggaggagctcttcagggacg-gggtga----actgg
H2N5Y9_MCL1-01          gctgtcctgcctctgctggagttggtcggggaatctggtaataacaccag
H2NN92_BCL2L10-01       ----------cgctgctggagag----agggccgctggtgaccgcccggt
                                     **    *          *       * *     *   

H2NNZ9_BCL2A1-01        ggaagaattgtaaccatatttgcatttg--aaggtattctcatcaagaaa
A0A2J8VIH3_BCL2L1-      ggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaag
H2NWH5_BCL2-01          gggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagag
H2N5Y9_MCL1-01          tacggacgggtcactaccctcgacgccg--ccgccagcagaggaggagga
H2NN92_BCL2L10-01       ggaagaagtggggcttcc-----agccg--cggctaaaggagcaggaggg
                            *    *   *             *    *                 

H2NNZ9_BCL2A1-01        cttctacgacagcaaattgccccggatgtggatacttacaaggagatttc
A0A2J8VIH3_BCL2L1-      cgtagacaaggagatgcaggtattg--gtgagt-----cg--------ga
H2NWH5_BCL2-01          cgtcaaccgggagatgtcgcccctg--gtggacaacatcg--------cc
H2N5Y9_MCL1-01          ggacgagttgtaccggcagtcgctg--gagattatc------------tc
H2NN92_BCL2L10-01       cgac--------------gtcgccc--gggactgccagcg--------cc
                                          *        * *                    

H2NNZ9_BCL2A1-01        atattttgttgcggagttcg-----------------------tcatgaa
A0A2J8VIH3_BCL2L1-      ttgcagcttggatggccacttacc-------------------tgaatga
H2NWH5_BCL2-01          ctgtgg-atgactgagtacctgaa-------------------cc----g
H2N5Y9_MCL1-01          tcggtaccttcgggagcaggccaccggcgccaaggacacaaagccattgg
H2NN92_BCL2L10-01       tggtggccttgctgagctcgcggc-------------------tcgtggg
                                *    *                                    

H2NNZ9_BCL2A1-01        taacacaggaggatggataaagc--------------aaaacggaggct-
A0A2J8VIH3_BCL2L1-      ccacctagagccttggatccagg--------------agaacggcggct-
H2NWH5_BCL2-01          gcacctgcacacctggatccagg--------------ataacggaggct-
H2N5Y9_MCL1-01          gcaggtctggggccacctgcaggaaggctctggagaccttacgacgggtt
H2NN92_BCL2L10-01       gcagcaccgcgcctggctgcagg--------------ctcagggcggct-
                          *              *  **                  * *  ** * 

H2NNZ9_BCL2A1-01        -gggaaaa------------------------------------------
A0A2J8VIH3_BCL2L1-      -gggatacttt---------------------------------------
H2NWH5_BCL2-01          -gggatgcctt---------------------------------------
H2N5Y9_MCL1-01          ggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcg
H2NN92_BCL2L10-01       -gggatggctt---------------------------------------
                         ****                                             

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      ---------------------------tgtggaa----------------
H2NWH5_BCL2-01          ---------------------------tgtggaa---ctgt---------
H2N5Y9_MCL1-01          gaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtga
H2NN92_BCL2L10-01       -------------------------------------ttgt---------
                                                                          

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
H2NWH5_BCL2-01          ------acggccccagca-------------------------tgcggcc
H2N5Y9_MCL1-01          tggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgact
H2NN92_BCL2L10-01       -----cacttcttcag------------------------------gacc
                                                                          

H2NNZ9_BCL2A1-01        ----------------tggctttgtaa-----------------------
A0A2J8VIH3_BCL2L1-      -------------------ctctatgg-----------------------
H2NWH5_BCL2-01          tctgtttgatttctcctggctgtctct-----------------------
H2N5Y9_MCL1-01          ctcattt--cttttggtgcctttgtggctaaacacttgaagaccataaac
H2NN92_BCL2L10-01       ccc------cttccgctggctttttgg-----------------------
                                           ** * *                         

H2NNZ9_BCL2A1-01        --agaagcttgagcctaaat------------------------------
A0A2J8VIH3_BCL2L1-      ---gaacaatgcagc-agctgagagccgaaagggccaggaacgcttcaac
H2NWH5_BCL2-01          ---gaagact----------------------------------------
H2N5Y9_MCL1-01          caagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgt
H2NN92_BCL2L10-01       --agaaaacagc--------------------tggtccaggcttttctgt
                           ***                                            

H2NNZ9_BCL2A1-01        ---------------ctggctggatgacttttgaagttacaggaaagatc
A0A2J8VIH3_BCL2L1-      -----------------cgctggtt--------------cctgacgggca
H2NWH5_BCL2-01          ---------------ctgctcagtt-------------------tggccc
H2N5Y9_MCL1-01          aaggacaaaacgggactggctagttaaacaaagaggc--tgggatgggtt
H2NN92_BCL2L10-01       ---------------catgcttgttaacaacag-----------------
                                              * *                         

H2NNZ9_BCL2A1-01        tgtgaaatgctctct-----------------------------------
A0A2J8VIH3_BCL2L1-      tgactgtggccggcgtg---------------------------------
H2NWH5_BCL2-01          tggtgggagcttgcatc---------------------------------
H2N5Y9_MCL1-01          tgtggagttcttccatgtagaggacctagaaggaggcatcagaaatgtgc
H2NN92_BCL2L10-01       ---------ccttcattta-------------------------------
                                 *   *                                    

H2NNZ9_BCL2A1-01        ------------------cttctgaag---------------caatactg
A0A2J8VIH3_BCL2L1-      ------------------gttctgctgggctcactcttcagtcggaaatg
H2NWH5_BCL2-01          ------------------accctgggtgcctatctgggc---cacaagtg
H2N5Y9_MCL1-01          tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatcta
H2NN92_BCL2L10-01       ------------------tctctgga----------------cacgatta
                                             ***                  *     * 

H2NNZ9_BCL2A1-01        t--------
A0A2J8VIH3_BCL2L1-      a--------
H2NWH5_BCL2-01          a--------
H2N5Y9_MCL1-01          ataagatag
H2NN92_BCL2L10-01       ttatga---
                                 

© 1998-2018