Dataset for CDS MCL-1 of organism Poecilia reticulata

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9Q4R7_MCL1-02      atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaa
A0A3P9Q4R7_MCL1-01      atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaa
                        **************************************************

A0A3P9Q4R7_MCL1-02      tggagtcgggaatggacaaacacactacgaccaggggctcgttgtgcctg
A0A3P9Q4R7_MCL1-01      tggagtcgggaatggacaaacacactacgaccaggggctcgttgtgcctg
                        **************************************************

A0A3P9Q4R7_MCL1-02      aagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatccc
A0A3P9Q4R7_MCL1-01      aagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatccc
                        **************************************************

A0A3P9Q4R7_MCL1-02      ttcaagaaacgcccgacgaatcttgcagtgactgcatcgaatggatatgt
A0A3P9Q4R7_MCL1-01      ttcaagaaacgcccgacgaatcttgcagtgactgcatcgaatggatatgt
                        **************************************************

A0A3P9Q4R7_MCL1-02      tgcaaaaagcctcccggagagcagcgacgacagcgacgaaggctctctgc
A0A3P9Q4R7_MCL1-01      tgcaaaaagcctcccggagagcagcgacgacagcgacgaaggctctctgc
                        **************************************************

A0A3P9Q4R7_MCL1-02      catgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgt
A0A3P9Q4R7_MCL1-01      catgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgt
                        **************************************************

A0A3P9Q4R7_MCL1-02      gcgagcaaccaagtgctggataacgacacaacggagcttattagcagttt
A0A3P9Q4R7_MCL1-01      gcgagcaaccaagtgctggataacgacacaacggagcttattagcagttt
                        **************************************************

A0A3P9Q4R7_MCL1-02      tctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
A0A3P9Q4R7_MCL1-01      tctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
                        **************************************************

A0A3P9Q4R7_MCL1-02      ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacaga
A0A3P9Q4R7_MCL1-01      ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacaga
                        **************************************************

A0A3P9Q4R7_MCL1-02      tatgcatacaatggtatgctcagcaagcttgctctggataaccagccgga
A0A3P9Q4R7_MCL1-01      tatgcatacaatggtatgctcagcaagcttgctctggataaccagccgga
                        **************************************************

A0A3P9Q4R7_MCL1-02      caatatggggtttgttacggaagtagcagagagtctcttttcagacggga
A0A3P9Q4R7_MCL1-01      caatatggggtttgttacggaagtagcagagagtctcttttcagacggga
                        **************************************************

A0A3P9Q4R7_MCL1-02      ccaccaactggggtcggatcgtcagcctggtggcgttcggggctgtagtg
A0A3P9Q4R7_MCL1-01      ccaccaactggggtcggatcgtcagcctggtggcgttcggggctgtagtg
                        **************************************************

A0A3P9Q4R7_MCL1-02      tgtcagcacctgaaggagaggggcagagagcactgcgtggatctggtgag
A0A3P9Q4R7_MCL1-01      tgtcagcacctgaaggagaggggcagagagcactgcgtggatctggtgag
                        **************************************************

A0A3P9Q4R7_MCL1-02      ccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaa
A0A3P9Q4R7_MCL1-01      ccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaa
                        **************************************************

A0A3P9Q4R7_MCL1-02      aaaacaactcatgggagggctttgtggagttctttagagtatcagaccct
A0A3P9Q4R7_MCL1-01      aaaacaactcatgggagggctttgtggagttctttagagtatcagaccct
                        **************************************************

A0A3P9Q4R7_MCL1-02      gagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
A0A3P9Q4R7_MCL1-01      gagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
                        **************************************************

A0A3P9Q4R7_MCL1-02      tggggcaacattagcctttctcatcag---gtga
A0A3P9Q4R7_MCL1-01      tggggcaacattagcctttctcatcagcaagtaa
                        ***************************   ** *

© 1998-2019