Dataset for CDS BCL-2-like of organism Poecilia reticulata

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9NE65_BCL2L10      atgcgccgaggttctccttccgccgtctggatgtgcagag---agccgtc
A0A3P9Q4I8_MCL1-02      atg----------------acggctaattcgacaaccgcgttaaactatc
A0A3P9Q4I8_MCL1-01      atg----------------acggctaattcgacaaccgcgttaaactatc
A0A3P9N9Y4_BCL2L1-      atg----------------tc-----ac---gaaacagag---aactggt
A0A3P9QFB3_BCL2L1-      atg----------------tc-----ctacagcaacagag---aactggt
                        ***                 *              * * *   * *    

A0A3P9NE65_BCL2L10      acatatcgctgggaggaaaatgtcctgtgggctgtggaaagagaccgtgg
A0A3P9Q4I8_MCL1-02      tcattttttc----acaaaatggagtcgggaatggacaaacacactacga
A0A3P9Q4I8_MCL1-01      tcattttttc----acaaaatggagtcgggaatggacaaacacactacga
A0A3P9N9Y4_BCL2L1-      gcttttctac----attaagt--------------ttaaac---------
A0A3P9QFB3_BCL2L1-      ggagttctac----ataagct--------------acaaat---------
                             *           *  *                ***          

A0A3P9NE65_BCL2L10      c-------------tgtcgcag--------------------aggattac
A0A3P9Q4I8_MCL1-02      ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaat---
A0A3P9Q4I8_MCL1-01      ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaat---
A0A3P9N9Y4_BCL2L1-      --------------tatctcag--------------------aggaa---
A0A3P9QFB3_BCL2L1-      --------------tgtctcag--------------------agaaa---
                                      *  *  *                     ** *    

A0A3P9NE65_BCL2L10      atccacctgcgctgctcaaacccacacccagcccctccac----------
A0A3P9Q4I8_MCL1-02      -----------ctcttcattcgcctatggatcccttcaagaaacgcccga
A0A3P9Q4I8_MCL1-01      -----------ctcttcattcgcctatggatcccttcaagaaacgcccga
A0A3P9N9Y4_BCL2L1-      -----------ctatccgatccaacacatattgcccaatgag--------
A0A3P9QFB3_BCL2L1-      -----------ctattcaagc----------tctctgctgag--------
                                   **   *   *                             

A0A3P9NE65_BCL2L10      --------------------------------------------ctccca
A0A3P9Q4I8_MCL1-02      cgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccg
A0A3P9Q4I8_MCL1-01      cgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccg
A0A3P9N9Y4_BCL2L1-      --------------------------------------------cccccg
A0A3P9QFB3_BCL2L1-      --------------------------------------------gtccga
                                                                      **  

A0A3P9NE65_BCL2L10      gcgagccggccgccgccatgaggcg-------------------cctggc
A0A3P9Q4I8_MCL1-02      gagagc--agcgacgaca-gcgacgaaggctctctgccatgcaccccggc
A0A3P9Q4I8_MCL1-01      gagagc--agcgacgaca-gcgacgaaggctctctgccatgcaccccggc
A0A3P9N9Y4_BCL2L1-      gacagc--accgctgcca-gggacg---------------------cggc
A0A3P9QFB3_BCL2L1-      g----------gccgacg-gggcca---------------------ggac
                        *          *  * *  * * *                       * *

A0A3P9NE65_BCL2L10      cc---aggacgtggaggc--------------------ccagcaccag--
A0A3P9Q4I8_MCL1-02      gcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaag
A0A3P9Q4I8_MCL1-01      gcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaag
A0A3P9N9Y4_BCL2L1-      cg---gggacggggggatggacg----------acgagcagacgttggag
A0A3P9QFB3_BCL2L1-      caattgggac--ggggacagccg----------gggccctagcaatg---
                               ***   *                        *   *       

A0A3P9NE65_BCL2L10      --gctcgct---------------ttcactccctg--------------g
A0A3P9Q4I8_MCL1-02      t-gctggataacgacacaacggagcttattagcagttttctaagaaattt
A0A3P9Q4I8_MCL1-01      t-gctggataacgacacaacggagcttattagcagttttctaagaaattt
A0A3P9N9Y4_BCL2L1-      acgcacgctaat---------gggacttttaacgg--------gacaagt
A0A3P9QFB3_BCL2L1-      --gcccgctggtca-acagccgggctggctcccgg--------gggaagt
                          **  * *                    *  * *               

A0A3P9NE65_BCL2L10      cccagggcttcc--------------------------------------
A0A3P9Q4I8_MCL1-02      tactggactttcaaagtg----------tcggtggagtcaaaataaagct
A0A3P9Q4I8_MCL1-01      tactggactttcaaagtg----------tcggtggagtcaaaataaagct
A0A3P9N9Y4_BCL2L1-      -ccaggatccccgaggcggcaacaggcggcgtcggcgtcaa-------cg
A0A3P9QFB3_BCL2L1-      cccagggccctc----------------ccgtcgaggtc-----------
                          * **     *                                      

A0A3P9NE65_BCL2L10      ----------tgaa----gcactgcgggacggatc---------------
A0A3P9Q4I8_MCL1-02      ctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagat-
A0A3P9Q4I8_MCL1-01      ctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagat-
A0A3P9N9Y4_BCL2L1-      atggacgcggtgaaagtgaccctgcgagacacggcccgtgagttcgagct
A0A3P9QFB3_BCL2L1-      ---------gtcaaatcggttctgaaggacgcggcagaggagtttgaacg
                                  * **        **   ***                    

A0A3P9NE65_BCL2L10      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      ------------atgcatacaatggtatgctcagcaagcttgctctggat
A0A3P9Q4I8_MCL1-01      ------------atgcatacaatggtatgctcagcaagcttgctctggat
A0A3P9N9Y4_BCL2L1-      gcgctactccc-gcgccttcaacgaccttcacagcacg------ctgcac
A0A3P9QFB3_BCL2L1-      cctctacacccaaagctttaaacacctttccttgca-g------ctggac
                                                                          

A0A3P9NE65_BCL2L10      ----------------tctgctccaacctcagaaaggtgatggatgaga-
A0A3P9Q4I8_MCL1-02      aaccagccggaca------atatggggtttgttacggaagtagcagagag
A0A3P9Q4I8_MCL1-01      aaccagccggaca------atatggggtttgttacggaagtagcagagag
A0A3P9N9Y4_BCL2L1-      atcacaccggccaccgcctaccagagcttcgagaacgtgatggacgagg-
A0A3P9QFB3_BCL2L1-      atcacccccgacacggcctaccacagcttcaagaccgtgctggatgagt-
                                                    *    *  *   * *  ***  

A0A3P9NE65_BCL2L10      --tggtgggagatggacactttaactgggggagggtggtgtccctcttcg
A0A3P9Q4I8_MCL1-02      tctcttttcagacgggaccaccaactggggtcggatcgtcagcctggtgg
A0A3P9Q4I8_MCL1-01      tctcttttcagacgggaccaccaactggggtcggatcgtcagcctggtgg
A0A3P9N9Y4_BCL2L1-      --tgttccgggacgg---cgtcaactggggccgcatcgtggggctcttcg
A0A3P9QFB3_BCL2L1-      --tgttcaagggcga---ggtcaactggggtcgggtggtggccatgttta
                          *  *    *  *        ********  *  * **     *  *  

A0A3P9NE65_BCL2L10      ccttcgccggcgtgctggccagacagc---tgcgggaacagacgggcaag
A0A3P9Q4I8_MCL1-02      cgttcggggctgtagtgtgtcagca------cctgaaggagaggggcaga
A0A3P9Q4I8_MCL1-01      cgttcggggctgtagtgtgtcagca------cctgaaggagaggggcaga
A0A3P9N9Y4_BCL2L1-      cgtttggtggcgcgctctgcgtggagtgtgtggagaaggagatgagc---
A0A3P9QFB3_BCL2L1-      cctttggggggattctgtgtgtggactgcgtccagaagaatatgagc---
                        * ** *  *      *        *         * *  * * * **   

A0A3P9NE65_BCL2L10      aacccggggccggactccgggaagcagcaggaactgcaacaagagaccgt
A0A3P9Q4I8_MCL1-02      gagcactgcgtggatctggtgagccagga---------------------
A0A3P9Q4I8_MCL1-01      gagcactgcgtggatctggtgagccagga---------------------
A0A3P9N9Y4_BCL2L1-      ------------cacctggt-agccagga---------------------
A0A3P9QFB3_BCL2L1-      ------------gagctggt-ctcccgca---------------------
                                     *    *     * * *                     

A0A3P9NE65_BCL2L10      aagctgccgggcgctggcggagaccattgctgatta---cctggagaagc
A0A3P9Q4I8_MCL1-02      ------------------------aatatccacgtatctcctggcaaagc
A0A3P9Q4I8_MCL1-01      ------------------------aatatccacgtatctcctggcaaagc
A0A3P9N9Y4_BCL2L1-      --------------ttgtagagtggatgaccgtcta---cctggatgagc
A0A3P9QFB3_BCL2L1-      --------------ttgctgaatggatgaccactta---cttggacgagc
                                                 **  *    **   * ***   ***

A0A3P9NE65_BCL2L10      acaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagc
A0A3P9Q4I8_MCL1-02      agcggga---ctggctagcaaaaaacaactcatgggagggcttt----gt
A0A3P9Q4I8_MCL1-01      agcggga---ctggctagcaaaaaacaactcatgggagggcttt----gt
A0A3P9N9Y4_BCL2L1-      ggattgaaccttgggtggagagccaaggaggatgggagcgtttc----gc
A0A3P9QFB3_BCL2L1-      agctcaatccctggatccagagccagggaggatgggaccacttc----gc
                              *    *** *        *      ******    **     * 

A0A3P9NE65_BCL2L10      tatgccct----------caatgc--------cagaga----agtaagtc
A0A3P9Q4I8_MCL1-02      ggagttctttagagtatcagaccctgagtctacagtgag--gaacacgct
A0A3P9Q4I8_MCL1-01      ggagttctttagagtatcagaccctgagtctacagtgag--gaacacgct
A0A3P9N9Y4_BCL2L1-      tgagatcttcggggg---caacgcgg---cggcagagagcagaagatctc
A0A3P9QFB3_BCL2L1-      taacctgtacggcca---ggacgccg---ctgcagagggccggaggtttc
                               *            *  *        *** *             

A0A3P9NE65_BCL2L10      aggactcctccatgaagacggcgctggttgctg---------tcgccggg
A0A3P9Q4I8_MCL1-02      gatggcgtttgttggggtcgctggtattgggg----------caacatta
A0A3P9Q4I8_MCL1-01      gatggcgtttgttggggtcgctggtattgggg----------caacatta
A0A3P9N9Y4_BCL2L1-      aggagagcttcaaaaactggctgctgctggggatgagcgtggtgac---g
A0A3P9QFB3_BCL2L1-      gggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccgga
                                *          *  * *  * *               *    

A0A3P9NE65_BCL2L10      gtcggcatcgctgggctcaccttccttctggtgcgctag---
A0A3P9Q4I8_MCL1-02      gcctttctcatca---------------------g---gtga
A0A3P9Q4I8_MCL1-01      gcctttctcatca---------------------gcaagtaa
A0A3P9N9Y4_BCL2L1-      gccttcatagccgggtccatctttgcccagaagcgcctgtga
A0A3P9QFB3_BCL2L1-      gctctgctcgtcatgtttatc---gctaagaaacg---atga
                        *      *                          *       

© 1998-2019