Dataset for CDS BCL2L1 of organism Poecilia reticulata

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9N9Y4_BCL2L1-      atgtcac---gaaacagagaactggtgcttttctacattaagtttaaact
A0A3P9QFB3_BCL2L1-      atgtcctacagcaacagagaactggtggagttctacataagctacaaatt
                        *****     * ***************   ******** *  *  *** *

A0A3P9N9Y4_BCL2L1-      atctcagaggaactatccgatccaacacatattgcccaatgagcccccgg
A0A3P9QFB3_BCL2L1-      gtctcagagaaactattcaagc----------tctctgctgaggtccgag
                         ******** ****** * * *          *  *   ****  **  *

A0A3P9N9Y4_BCL2L1-      acagcaccgctgccagggacgcggccg---gggacggggggatggacgac
A0A3P9QFB3_BCL2L1-      --------gccgacggggccaggaccaattgggac--ggggacagccggg
                                ** * * *** *  * **    *****  *****  * **  

A0A3P9N9Y4_BCL2L1-      gagcagacgttggagacgcacgctaat--------gggacttttaacggg
A0A3P9QFB3_BCL2L1-      gccctagcaatg-----gcccgctggtcaacagccgggctggctcccggg
                        *  *   *  **     ** ****  *        ***     *  ****

A0A3P9N9Y4_BCL2L1-      acaagt-ccaggatccccgaggcggcaacaggcggcgtcggcgtcaacga
A0A3P9QFB3_BCL2L1-      ggaagtcccagggccctc----------------ccgtcgaggtc-----
                          **** *****  ** *                 *****  ***     

A0A3P9N9Y4_BCL2L1-      tggacgcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctg
A0A3P9QFB3_BCL2L1-      --------gtcaaatcggttctgaaggacgcggcagaggagtttgaacgc
                                ** ***  *   ***   *** ****    ***** ** *  

A0A3P9N9Y4_BCL2L1-      cgctactccc-gcgccttcaacgaccttcacagcacgctgcacatcacac
A0A3P9QFB3_BCL2L1-      ctctacacccaaagctttaaacacctttccttgca-gctggacatcaccc
                        * **** ***   ** ** ***  * ***   *** **** ******* *

A0A3P9N9Y4_BCL2L1-      cggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgg
A0A3P9QFB3_BCL2L1-      ccgacacggcctaccacagcttcaagaccgtgctggatgagttgttcaag
                        * * *** ******** ****** *** **** **** *** *****  *

A0A3P9N9Y4_BCL2L1-      gacggcgtcaactggggccgcatcgtggggctcttcgcgtttggtggcgc
A0A3P9QFB3_BCL2L1-      ggcgaggtcaactggggtcgggtggtggccatgtttacctttggggggat
                        * **  *********** **  * ****   * **  * ***** **   

A0A3P9N9Y4_BCL2L1-      gctctgcgtggagtgtgtggagaaggagatgagccacctggtagccagga
A0A3P9QFB3_BCL2L1-      tctgtgtgtggactgcgtccagaagaatatgagcgagctggtctcccgca
                         ** ** ***** ** **  ***** * ****** * *****  ** * *

A0A3P9N9Y4_BCL2L1-      ttgtagagtggatgaccgtctacctggatgagcggattgaaccttgggtg
A0A3P9QFB3_BCL2L1-      ttgctgaatggatgaccacttacttggacgagcagctcaatccctggatc
                        ***  ** *********   *** **** **** * *  * ** *** * 

A0A3P9N9Y4_BCL2L1-      gagagccaaggaggatgggagcgtttcgctgagatcttcgggggcaacgc
A0A3P9QFB3_BCL2L1-      cagagccagggaggatgggaccacttcgctaacctgtacggccaggacgc
                         ******* *********** *  ****** *  * * ***     ****

A0A3P9N9Y4_BCL2L1-      ggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgc
A0A3P9QFB3_BCL2L1-      cgctgcagagggccggaggtttcgggagaccttgaacaaatggctgctag
                         ** ****** ** * ** * ** ***** *** ** ** ********  

A0A3P9N9Y4_BCL2L1-      tggggatgagcgtggtgac---ggccttcatagccgggtccatctttgcc
A0A3P9QFB3_BCL2L1-      tcggtgtggctctgctgaccggagctctgctcgtcatgtttatc---gct
                        * **  **    ** ****    **  *  * * *  **  ***   ** 

A0A3P9N9Y4_BCL2L1-      cagaagcgcctgtga
A0A3P9QFB3_BCL2L1-      aagaaacg---atga
                         **** **    ***

© 1998-2019