Dataset for CDS BCL2L1 of organism Poecilia mexicana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3WI27_BCL2L1-      atgtcac---gaaacagagaactggtgcttttctacattaagtttaaact
A0A3B3XN57_BCL2L1-      atgtcctacagcaacagagaactggtggagttctacataagctacaaatt
                        *****     * ***************   ******** *  *  *** *

A0A3B3WI27_BCL2L1-      gtctcagaggaactatccgatccaacacatattgcccaatgagcccccgg
A0A3B3XN57_BCL2L1-      gtctcagagaaactattcaagctctctgctgaggtccgaggccgacgggg
                        ********* ****** * * *   *   *   * ** * *    *  **

A0A3B3WI27_BCL2L1-      acagcaccgct---gctggggacgcggccggggacgcggggatggacgac
A0A3B3XN57_BCL2L1-      ccaggaccaattgggacgggga--cagccggggccctagcaatggcccgc
                         *** ***  *   *  *****  * ******* *   *  **** *  *

A0A3B3WI27_BCL2L1-      gagcagacgttggagacgcacgctaatgggacttttaacgggacaagtcc
A0A3B3XN57_BCL2L1-      tggtcaacagctgggccggctccccagggaagt--------------ccc
                          *   **    * * **    *  * ** * *               **

A0A3B3WI27_BCL2L1-      aggatccccgaggcggcaacaggcggcgtcggcggcaacgatggacgcgg
A0A3B3XN57_BCL2L1-      aggaccctc----------ccaccggcgtc-------------gaggttg
                        **** ** *          *   *******             ** *  *

A0A3B3WI27_BCL2L1-      tgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcc
A0A3B3XN57_BCL2L1-      tcaaatcggttctgaaggacgcggcagaggagtttgaacgcctctacacc
                        * ***  *   ***   *** ****    ***** ** *  * **** **

A0A3B3WI27_BCL2L1-      c-gcgccttcaacgaccttcacagcacgctgcacatcacaccggccaccg
A0A3B3XN57_BCL2L1-      caaagctttaaacacctttccttgca-gctggacatcacccccgacacgg
                        *   ** ** ***  * ***   *** **** ******* ** * *** *

A0A3B3WI27_BCL2L1-      cgtaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtc
A0A3B3XN57_BCL2L1-      cctaccagagcttcaagactgtgctggatgagttattcaagggtgaggtc
                        * ************ ***  *** **** *** * ***  **  *  ***

A0A3B3WI27_BCL2L1-      aactggggccgaatcgtggggctcttcgcgtttggtggcgcgctctgcgt
A0A3B3XN57_BCL2L1-      aactggggtcgggtggtggccatgtttacctttgggggaattctgtgtgt
                        ******** **  * ****   * **  * ***** **    ** ** **

A0A3B3WI27_BCL2L1-      ggagtgtgtggagaaggagatgagccacctggtagccaggattgtagagt
A0A3B3XN57_BCL2L1-      ggattgcgttcagaagaatatgagtgagctggtctcccgcattgccgaat
                        *** ** **  ***** * *****  * *****  ** * ****  ** *

A0A3B3WI27_BCL2L1-      ggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaa
A0A3B3XN57_BCL2L1-      ggatgaccacttacctggacgagcagctcaatccctggatccagagccag
                        ********   *** **** **** * *  * ** *** *  ******* 

A0A3B3WI27_BCL2L1-      ggaggatgggaccgtttcgctgagatcttcgggggcaacgcggcggcaga
A0A3B3XN57_BCL2L1-      ggaggatgggaccgcttcgctaacctgtacggccaggacgccgctgcaga
                        ************** ****** *  * * ***     **** ** *****

A0A3B3WI27_BCL2L1-      gagcagaagatctcaggagagcttcaaaaactggctgctgctggggatga
A0A3B3XN57_BCL2L1-      gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtgg
                        * ** * ** * ** ***** *** ** ** ********  * **  ** 

A0A3B3WI27_BCL2L1-      gtgtggtgac---ggccttcatagccgggtccatcttcgcccagaagcgc
A0A3B3XN57_BCL2L1-      ctctgctgaccggagctctgctcgtcatgt---ttgtcgctaagaaacg-
                         * ** ****    **  *  * * *  **   *  ****  **** ** 

A0A3B3WI27_BCL2L1-      ctgtga
A0A3B3XN57_BCL2L1-      --atga
                           ***

© 1998-2019