Dataset for CDS BCL2L1 of organism Periophthalmus magnuspinnatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4BFZ8_BCL2L1-      atgtctcccagtaaccgagagctggttgaattcttcataagctacaaatt
A0A3B3ZN55_BCL2L1-      atgtccctc---aacagagaactggtggaattctacatccagtacaaact
A0A3B3ZN55_BCL2L1-      atgtccctc---aacagagaactggtggaattctacatccagtacaaact
                        ***** * *   *** **** ***** ******* ***    ****** *

A0A3B4BFZ8_BCL2L1-      atcacagaaaaactacccaagttcgctgcttatgtcagaccccgctaggg
A0A3B3ZN55_BCL2L1-      gtctcagcgggactgtcc---t---------ctgg-------ggctggag
A0A3B3ZN55_BCL2L1-      gtctcagcgggactgtcc---tctgcagcacctgg-------ggctgggg
                         ** ***    ***  **   *          **         *** * *

A0A3B4BFZ8_BCL2L1-      tccagtgtg-------------agggcaacaaggcagctaatgtcccgaa
A0A3B3ZN55_BCL2L1-      gatggtacggagattgacacagagagagacagggaccttctgggactggg
A0A3B3ZN55_BCL2L1-      gacagga---------gcacacagagtgacacggagcatcttggacttgg
                            *                 ** *  *** **    *   *  *    

A0A3B4BFZ8_BCL2L1-      tggtatgctaacaaaccggaa--tggcaacagacaa--------------
A0A3B3ZN55_BCL2L1-      ggacaggagcgtggacaggaactccacccc---------ctcacttag--
A0A3B3ZN55_BCL2L1-      ggataggggcgtagacagg-gctcggctgcagagagaaacagaggtggac
                         *  * *       ** **       *  *                    

A0A3B4BFZ8_BCL2L1-      --------acactggcctcactgc-ctcctgatgat--------------
A0A3B3ZN55_BCL2L1-      --------actcagacttgactccgcctctgattctgccccc--------
A0A3B3ZN55_BCL2L1-      agtacggaactcagacttgactccgcctctgattctgcccccgtccacag
                                ** * * * * *** * *  *****  *              

A0A3B4BFZ8_BCL2L1-      ----------------cacttagacgctattaagactgctctgacggact
A0A3B3ZN55_BCL2L1-      -------------------------------------gctcttcgtgact
A0A3B3ZN55_BCL2L1-      ccccgcccccttgttggacctggacgccgttaaagaggctcttcgtgact
                                                             *****    ****

A0A3B4BFZ8_BCL2L1-      ctgcagatgaatttgaagagttgttcacacaagcattcagcaacctttcc
A0A3B3ZN55_BCL2L1-      ccgctaatgagttcgagctccgttttagccgcgctttcagcgacctgcac
A0A3B3ZN55_BCL2L1-      ccgctaatgagttcgagctccgttttagccgcgctttcagcgacctgcac
                        * **  **** ** **       ** *  *  ** ****** ****   *

A0A3B4BFZ8_BCL2L1-      tctcagctcgacatcacacctgatacagcttataacagctttaaaagtgt
A0A3B3ZN55_BCL2L1-      cgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgt
A0A3B3ZN55_BCL2L1-      cgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgt
                           *****  ******* ** *  ***** *** * *****  * *****

A0A3B4BFZ8_BCL2L1-      catggacgaggtgttcaaagatggggttaattggggacggattgtgggtc
A0A3B3ZN55_BCL2L1-      catggacgaagtgttccgcgatggcgttaactgggggcgtgtcgttggcc
A0A3B3ZN55_BCL2L1-      catggacgaagtgttccgcgatggcgttaactgggggcgtgtcgttggcc
                        ********* ******   ***** ***** ***** **  * ** ** *

A0A3B4BFZ8_BCL2L1-      tttttgtttttggaggggttttgagtgtggagtgtgtggagaaggatatg
A0A3B3ZN55_BCL2L1-      tgtttgccttcgggggcgctctcgctgtggagtgtgtggacaaagagatg
A0A3B3ZN55_BCL2L1-      tgtttgccttcgggggcgctctcgctgtggagtgtgtggacaaagagatg
                        * ****  ** ** ** * * *   *************** ** ** ***

A0A3B4BFZ8_BCL2L1-      agcattctggttcctcgcattgctaactggatgactatctacctggatga
A0A3B3ZN55_BCL2L1-      agcaccctagtggctcgcatcgtcacctggatgactgtgtatctggacga
A0A3B3ZN55_BCL2L1-      agcaccctagtggctcgcatcgtcacctggatgactgtgtatctggacga
                        ****  ** **  ******* *  * ********** * ** ***** **

A0A3B4BFZ8_BCL2L1-      gaatatcgccacgtggattcaaaaccagggaggctgggccagctttgctc
A0A3B3ZN55_BCL2L1-      acacatccaagactggatcgactcgcaagggggatgggcccgtttcgcag
A0A3B3ZN55_BCL2L1-      acacatccaagactggatcgactcgcaagggggatgggcccgtttcgcag
                          * ***      *****  *    ** ** ** ****** * ** **  

A0A3B4BFZ8_BCL2L1-      aaatttttgggcagaatgcagcaggagaggccagaaggtcccgagagact
A0A3B3ZN55_BCL2L1-      agatctacgggcaggacgccgccgcgcagagccgccattccgaagaacgc
A0A3B3ZN55_BCL2L1-      agatctacgggcaggacgccgccgcgcagagccgccattccgaagaacgc
                        * ** *  ****** * ** ** *   **  * *    ***  ***    

A0A3B4BFZ8_BCL2L1-      ctgaagaaatggctgctagttggagtagggttgctagctggagtgctggt
A0A3B3ZN55_BCL2L1-      ttcaagaaatggctttttgccggaatgaccctggtcaccggggtcgtggt
A0A3B3ZN55_BCL2L1-      ttcaagaaatggctttttgccggaatgaccctggtcaccggggtcgtggt
                         * ***********  * *  *** *     ** *  * ** **  ****

A0A3B4BFZ8_BCL2L1-      tgctatgctcattgctaagaaa------tag
A0A3B3ZN55_BCL2L1-      ggggtcactgctcgcccagagacgcctgtga
A0A3B3ZN55_BCL2L1-      ggggtcactgctcgcccagagacgcctgtga
                         *     **  * **  *** *      *  

© 1998-2019