Dataset for CDS BCL-2-like of organism Pelodiscus sinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

K7G130_BCL2A1-01      atggaaagttc---------------------------------------
K7FPN7_MCL1-01        --------------------------------------------------
K7F655_BCL2L1-01      atgtcgaacac------------------taacagggaattagtgattga
K7F5Y4_BCL2-02        atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaa
K7F5Y4_BCL2-01        atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaa
K7F5Y4_BCL2-03        atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaa

K7G130_BCL2A1-01      ---------------------------tgagttccgctatgtttact---
K7FPN7_MCL1-01        ---------------------------gggatgcttcggaaacta-----
K7F655_BCL2L1-01      cttcctctcctacaagctatcgcagaggggacacagctggagctggttcg
K7F5Y4_BCL2-02        gtacatccattacaaactgtcacagagggggtatgattgg-gctgcc---
K7F5Y4_BCL2-01        gtacatccattacaaactgtcacagagggggtatgattgg-gctgcc---
K7F5Y4_BCL2-03        gtacatccattacaaactgtcacagagggggtatgattgg-gctgcc---
                                                  *              *      

K7G130_BCL2A1-01      --------atttagtccaggattatc--------tgaaatacattcttca
K7FPN7_MCL1-01        -----------gacatcaagaatgagg-------aggatc-------tca
K7F655_BCL2L1-01      agggggaggatgagatcaggactgaggctgcagaagaggcggagatggca
K7F5Y4_BCL2-02        --------aatgaaaacag---------------aggaccagtttcttca
K7F5Y4_BCL2-01        --------aatgaaaacag---------------aggaccagtttcttca
K7F5Y4_BCL2-03        --------aatgaaaacag---------------aggaccagtttcttca
                                  *   **                 *            **

K7G130_BCL2A1-01      ggaacct-------------------------------------------
K7FPN7_MCL1-01        agt-----------------------------------------------
K7F655_BCL2L1-01      agcgtcc---------ctaatgggagtccatcctggcatccaggtgccag
K7F5Y4_BCL2-02        agtctctctcctcctgctgctgggaccccatctgaccatgctgg-gctgg
K7F5Y4_BCL2-01        agtctctctcctcctgctgctgggaccccatctgaccatgctgg-gctgg
K7F5Y4_BCL2-03        agtctctctcctcctgctg-------------------------------

K7G130_BCL2A1-01      --------------------------------------------------
K7FPN7_MCL1-01        --------------------------------------------------
K7F655_BCL2L1-01      ccacgtagtgaacggggctgccgggcacagtaacagccttgaa---gccc
K7F5Y4_BCL2-02        tgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccc
K7F5Y4_BCL2-01        tgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccc
K7F5Y4_BCL2-03        ---------------------ctggttcggctgctgctagtaatgtgccc

K7G130_BCL2A1-01      ---------gagcttggaccagcccca-agcagagttgctcatgtcttaa
K7FPN7_MCL1-01        -------------------cagtgtcat----------------------
K7F655_BCL2L1-01      ----atgaaagggttc---cggcagccgaagtgaggca---ggcgctgag
K7F5Y4_BCL2-02        cttggtgatgggctgcgctcagcaccacaggctgttcacttgactctgtg
K7F5Y4_BCL2-01        cttggtgatgggctgcgctcagcaccacaggctgttcacttgactctgtg
K7F5Y4_BCL2-03        cttggtgatgggctgcgctcagcaccacaggctgttcacttgactctgtg
                                         * *   *                        

K7G130_BCL2A1-01      gaaattctgcatcttttcttcaaaaagaaaacgaagagatactgaaacca
K7FPN7_MCL1-01        --------------------------------------------------
K7F655_BCL2L1-01      agaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacc
K7F5Y4_BCL2-02        ccaagccggagatgaattttcccgccgctatcacagagattttgcccaga
K7F5Y4_BCL2-01        ccaagccggagatgaattttcccgccgctatcacagagattttgcccaga
K7F5Y4_BCL2-03        ccaagccggagatgaattttcccgccgctatcacagagattttgcccaga

K7G130_BCL2A1-01      tgtttggacacacttgatattacctctgtagatgctgccagaagaatttt
K7FPN7_MCL1-01        --------ca-gttgca----accc-------------------------
K7F655_BCL2L1-01      tcacttccca-gctccacatcaccct---gggcacggcttaccagagctt
K7F5Y4_BCL2-02        tgtctgggca-gctgcacttgacccc---attcacggccagggggcgctt
K7F5Y4_BCL2-01        tgtctgggca-gctgcacttgacccc---attcacggccagggggcgctt
K7F5Y4_BCL2-03        tgtctgggca-gctgcacttgacccc---attcacggccagggggcgctt
                              **   *  *    ***                          

K7G130_BCL2A1-01      cattcaagtcatggataaagaatttgatgatggaaacactaactgggggc
K7FPN7_MCL1-01        -----------------atgttttcagtgatggaataacaaactggggta
K7F655_BCL2L1-01      cgagcaggtggtgaatgaactcttccgggacggagt---gaactgggggc
K7F5Y4_BCL2-02        tgtggcggtggtggaggagctattccgagatgggat---taactggggaa
K7F5Y4_BCL2-01        tgtggcggtggtggaggagctattccgagatgggat---taactggggaa
K7F5Y4_BCL2-03        tgtggcggtggtggaggagctattccgagatgggat---taactggggaa
                                       *    **    ** **       ********  

K7G130_BCL2A1-01      ggattttgacaatatttatgtttggaggaattctttctaagaggcttcaa
K7FPN7_MCL1-01        gaattgtaacactcatctcttttggtgcctttgttgcaaaa-cacctgaa
K7F655_BCL2L1-01      gcattgtggcttttttctcctttggagga------gccctg-tgcgtgga
K7F5Y4_BCL2-02        ggatcgtggccttctttgaatttggtggc------gtgatg-tgtgtgga
K7F5Y4_BCL2-01        ggatcgtggccttctttgaatttggtggc------gtgatg-tgtgtgga
K7F5Y4_BCL2-03        ggatcgtggccttctttgaatttggtggc------gtgatg-tgtgtgga
                      * **  *  *  *  *    ***** *                   *  *

K7G130_BCL2A1-01      gaacacaaagttcagcttacaggaga---------------taataaaga
K7FPN7_MCL1-01        gagcataaa---------ccaggagaattgcatcaacacgctagcaggga
K7F655_BCL2L1-01      gagtgtgga---------caaggaga--tgcagg----tgttggtgggac
K7F5Y4_BCL2-02        gagtgtcaa---------ccgggaga--tgtcgc----ctcttgtggaca
K7F5Y4_BCL2-01        gagtgtcaa---------ccgggaga--tgtcgc----ctcttgtggaca
K7F5Y4_BCL2-03        gagtgtcaa---------ccgggaga--tgtcgc----ctcttgtggaca
                      **      *            *****               *        

K7G130_BCL2A1-01      gcagatttcttatttcatcacggagtacattataaacaccaaggctgaat
K7FPN7_MCL1-01        tc--atcac-----agatgtgcttgtctcagacaaacgagattggctagt
K7F655_BCL2L1-01      gc--atcgcctcttggatgaccacttacctgactgaccaccttgatccct
K7F5Y4_BCL2-02        gt--attgctgtgtggatgactgagtacctgaacagacacttgcacaact
K7F5Y4_BCL2-01        gt--attgctgtgtggatgactgagtacctgaacagacacttgcacaact
K7F5Y4_BCL2-03        gt--attgctgtgtggatgactgagtacctgaacagacacttgcacaact
                          **  *       **       *     *                 *

K7G130_BCL2A1-01      ggatagatgcaaatggaggctgggaaaacggcttcctacctatgtttgaa
K7FPN7_MCL1-01        taaccaaaga-------ggctgggag---ggatttgttgaattcttccgt
K7F655_BCL2L1-01      ggatccaagagaatggcggttgggag---cgctttgtggatctct---ac
K7F5Y4_BCL2-02        ggatccaggacaatggaggttggg--------------------------
K7F5Y4_BCL2-01        ggatccaggacaatggaggttgggat---gcctttgtggaattgt---at
K7F5Y4_BCL2-03        ggatccaggacaatggaggttgg---------------------------
                        *   * *        ** ***                           

K7G130_BCL2A1-01      gaaaaacaatcgtggctgtcattattcaacattaaagcaaaaatcatgga
K7FPN7_MCL1-01        gtaga---------------------ggatctagaaggtagcatcaggaa
K7F655_BCL2L1-01      gggaa---------------------cgatgctgctgccaagagcaggaa
K7F5Y4_BCL2-02        --------------------------------------------------
K7F5Y4_BCL2-01        ggcag---------------------caacatgaggcctttgtttgattt
K7F5Y4_BCL2-03        --------------------------------------------------

K7G130_BCL2A1-01      tgctttttccttcttca-----------------------------gtca
K7FPN7_MCL1-01        tgttctggtggcttttgcaggctttgctggactgggtgcaagcttggcgt
K7F655_BCL2L1-01      aggccaggagcagttcaacagggggctgctgacgggggcgactgtggccg
K7F5Y4_BCL2-02        --------------------------------ctggtgca---gtgagcg
K7F5Y4_BCL2-01        ctcctggatctctttgaagactatcctcagtcttgctctg---gtgggag
K7F5Y4_BCL2-03        --------------------------------------------------

K7G130_BCL2A1-01      gtattat----------------------------tga
K7FPN7_MCL1-01        acatgatgc------------------------gatga
K7F655_BCL2L1-01      gcgtgctcctcctgggctcgctgctgagccgcaagtag
K7F5Y4_BCL2-02        ttctc---------------------------------
K7F5Y4_BCL2-01        cttgcatcacccttggagcttatctgggacataagtga
K7F5Y4_BCL2-03        --------------------------------------

© 1998-2019