Dataset for CDS BCL-2 of organism Pelodiscus sinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


K7F5Y4_BCL2-02      atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccat
K7F5Y4_BCL2-01      atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccat
K7F5Y4_BCL2-03      atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccat
                    ************************************************************

K7F5Y4_BCL2-02      tacaaactgtcacagagggggtatgattgggctgccaatgaaaacagaggaccagtttct
K7F5Y4_BCL2-01      tacaaactgtcacagagggggtatgattgggctgccaatgaaaacagaggaccagtttct
K7F5Y4_BCL2-03      tacaaactgtcacagagggggtatgattgggctgccaatgaaaacagaggaccagtttct
                    ************************************************************

K7F5Y4_BCL2-02      tcaagtctctctcctcctgctgctgggaccccatctgaccatgctgggctggtgtctttg
K7F5Y4_BCL2-01      tcaagtctctctcctcctgctgctgggaccccatctgaccatgctgggctggtgtctttg
K7F5Y4_BCL2-03      tcaagtctctctcctcctgctg--------------------------------------
                    **********************                                      

K7F5Y4_BCL2-02      ccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
K7F5Y4_BCL2-01      ccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
K7F5Y4_BCL2-03      -------------ctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
                                 ***********************************************

K7F5Y4_BCL2-02      tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgc
K7F5Y4_BCL2-01      tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgc
K7F5Y4_BCL2-03      tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgc
                    ************************************************************

K7F5Y4_BCL2-02      tatcacagagattttgcccagatgtctgggcagctgcacttgaccccattcacggccagg
K7F5Y4_BCL2-01      tatcacagagattttgcccagatgtctgggcagctgcacttgaccccattcacggccagg
K7F5Y4_BCL2-03      tatcacagagattttgcccagatgtctgggcagctgcacttgaccccattcacggccagg
                    ************************************************************

K7F5Y4_BCL2-02      gggcgctttgtggcggtggtggaggagctattccgagatgggattaactggggaaggatc
K7F5Y4_BCL2-01      gggcgctttgtggcggtggtggaggagctattccgagatgggattaactggggaaggatc
K7F5Y4_BCL2-03      gggcgctttgtggcggtggtggaggagctattccgagatgggattaactggggaaggatc
                    ************************************************************

K7F5Y4_BCL2-02      gtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
K7F5Y4_BCL2-01      gtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
K7F5Y4_BCL2-03      gtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
                    ************************************************************

K7F5Y4_BCL2-02      cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaac
K7F5Y4_BCL2-01      cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaac
K7F5Y4_BCL2-03      cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaac
                    ************************************************************

K7F5Y4_BCL2-02      tggatccaggacaatggaggttggg-----------------------------------
K7F5Y4_BCL2-01      tggatccaggacaatggaggttgggatgcctttgtggaattgtatggcagcaacatgagg
K7F5Y4_BCL2-03      tggatccaggacaatggaggttgg------------------------------------
                    ************************                                    

K7F5Y4_BCL2-02      ----------------------------------------------ctggtgcagtgagc
K7F5Y4_BCL2-01      cctttgtttgatttctcctggatctctttgaagactatcctcagtcttgctctggtggga
K7F5Y4_BCL2-03      ------------------------------------------------------------
                                                                                

K7F5Y4_BCL2-02      gttctc---------------------------------
K7F5Y4_BCL2-01      gcttgcatcacccttggagcttatctgggacataagtga
K7F5Y4_BCL2-03      ---------------------------------------
                                                           

© 1998-2018