Dataset for CDS BCL2L1 of organism Paramormyrops kingsleyae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3QRZ2_BCL2L1-      atgtcttacagcaacagagaactggtgatggacttcataacgtataaact
A0A3B3TFR4_BCL2L1-      atgtcctacagcaatagggagctggtagagtactttgtcagctataagct
                        ***** ******** ** ** *****   * ****  * *  ***** **

A0A3B3QRZ2_BCL2L1-      gtcccagaggaacta---caatggccactttgggcttcctgaagacaggg
A0A3B3TFR4_BCL2L1-      ggcccagaagaattactccattgcccacatcatacaggacgaagccgacg
                        * ****** *** **   ** ** **** *    *     **** *   *

A0A3B3QRZ2_BCL2L1-      gtcggacagagggctcgggtcaggccgatgggcgcgagggggttatggta
A0A3B3TFR4_BCL2L1-      agcagacaggggg---aggtgagggcgaagca---gcaggcgctgtgg--
                          * ***** ***    *** *** *** *     *  ** * * ***  

A0A3B3QRZ2_BCL2L1-      acagcaactcatgtcaatgggtcggtcattgctggcggcaccagcagcca
A0A3B3TFR4_BCL2L1-      -------ctcatgccaatggatcggtcagtagcgggaactctgtgggcca
                               ****** ****** ******* *   **   * *     ****

A0A3B3QRZ2_BCL2L1-      ggtgtccccagtgcctgagcagccgctccattccccatcgccctctccac
A0A3B3TFR4_BCL2L1-      gggtgctcc----cctggaaggc-----------------gccacccccc
                        **   * **    ****    **                  ** * ** *

A0A3B3QRZ2_BCL2L1-      aaggcctggaggcggtgaaggaggcattgcgggattctgccaacgagttt
A0A3B3TFR4_BCL2L1-      agggcctggaggcggtgaaggaggcgctgcgactctcagccaacgaattt
                        * ***********************  ****    ** ******** ***

A0A3B3QRZ2_BCL2L1-      gagctacgctacagccgcgccttcagcgacctctcctcccagcttcacat
A0A3B3TFR4_BCL2L1-      gagttccggtaccagcgtgccttcagcgacctgtcgtcacagctgcatat
                        *** * ** ***   ** ************** ** ** ***** ** **

A0A3B3QRZ2_BCL2L1-      cacacccgtcacggcctaccagagctttgagagtgtaatgaacgaggtgt
A0A3B3TFR4_BCL2L1-      cacgccggccacagcctaccagagcttcgagagcgtcatgaacgaggtgt
                        *** ** * *** ************** ***** ** *************

A0A3B3QRZ2_BCL2L1-      tccgcgatggaatcaactggggccgcatcgtgggcctctttgcctttggc
A0A3B3TFR4_BCL2L1-      tccgggacggtgtcaactggggccgagtggtgggcctcttcgcctttggt
                        **** ** **  *************  * *********** ******** 

A0A3B3QRZ2_BCL2L1-      ggggccctgtgcgtggagtgtgtggagaaggagatgggccacctggtgga
A0A3B3TFR4_BCL2L1-      ggcgcgttgtgcgtggagtgtgtcgagaaggagatgagcccgctggtggg
                        ** **  **************** ************ ***  ******* 

A0A3B3QRZ2_BCL2L1-      tcgtattgctgactggatgaccgtttacctggacagcaacatccagccct
A0A3B3TFR4_BCL2L1-      ccacattgtggactggatgaccgtctacttggacaaccatatccagccct
                         *  ****  ************** *** ****** * * **********

A0A3B3QRZ2_BCL2L1-      ggatccagcggcagggaggatgggaccgttttgctgaaatctttgggaag
A0A3B3TFR4_BCL2L1-      ggattcaaacccaaggaggatgggatcgcttcgccgagatcttcggcaac
                        **** **    ** *********** ** ** ** ** ***** ** ** 

A0A3B3QRZ2_BCL2L1-      gatgcagcagctgagagcaggaggtcccaagagaacttcaaaaagtggct
A0A3B3TFR4_BCL2L1-      gacgcagccgccgaaggccgccgctctcgggagaggttccagcagtggct
                        ** ***** ** **  ** *  * ** *  ****  *** *  *******

A0A3B3QRZ2_BCL2L1-      gttagctgggatgacgctcatcactggagttgttgtgggctctctcattg
A0A3B3TFR4_BCL2L1-      gccggcggcgatggcgctggtcgcgggagcgctggtcggcttcctcatcg
                        *   ** * **** ****  ** * ****   * ** ****  ***** *

A0A3B3QRZ2_BCL2L1-      cacagaagcgcctgtga
A0A3B3TFR4_BCL2L1-      ccaagaaacgccagtga
                        *  **** **** ****

© 1998-2019