Dataset for CDS BCL-2-like of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096NMX5_BCL2A1-      atgacagact------------------gtgaatttggatatatt-----
A0A096NMX5_BCL2A1-      atgacagact------------------gtgaatttggatatatt-----
A0A2I3LFM0_MCL1-01      atgtttggcctcaaaagaaacgc-----ggtaatcggact----------
A0A2I3LFM0_MCL1-03      atgtttggcctcaaaagaaacgc-----ggtaatcggact----------
A0A096NM44_BCL2L10      atggc---------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      atgtctcag-------------------agcaaccgggagctggtggttg
A0A096MPU7_BCL2-01      atggcgcacgctgggagaacagggtac-gataaccgggagatagtgatga
A0A096NX09_BCL2L2-      atggcgacccc----agcctcggccccagacacacgggctctggtggcag
A0A096NX09_BCL2L2-      atggcgacccc----agcctcggccccagacacacgggctctggtggcag
                                                                          

A0A096NMX5_BCL2A1-      -----------tacaggctagctcaggactatttgcagtacgttctgca-
A0A096NMX5_BCL2A1-      -----------tacaggctagctcaggactatttgcagtacgttctgca-
A0A2I3LFM0_MCL1-01      -------------caacctctactgtgg------gggggccggcttgggg
A0A2I3LFM0_MCL1-03      -------------caacctctactgtgg------gggggccggcttgggg
A0A096NM44_BCL2L10      -------------tgacccgttgcggga------gcgcaccgagcggctc
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      actttctctcctacaagctttcccagaa------aggatacagctggagt
A0A096MPU7_BCL2-01      agtacatccactataagctgtcgcagag------gggctacgagtgggat
A0A096NX09_BCL2L2-      actttgtaggttataagctgaggcagaa------gggttatgtctg----
A0A096NX09_BCL2L2-      actttgtaggttataagctgaggcagaa------gggttatgtctg----
                                                                          

A0A096NMX5_BCL2A1-      ------------------------gataccacaacctgg-----------
A0A096NMX5_BCL2A1-      ------------------------gataccacaacctgg-----------
A0A2I3LFM0_MCL1-01      gccggcagcgg------------cggcgccacccctccg-----------
A0A2I3LFM0_MCL1-03      gccggcagcgg------------cggcgccacccctccg-----------
A0A096NM44_BCL2L10      ctggccgactatctgg--------ggtgct--gcgcccg-----------
A0A096NV05_BCL2L1-      ----------atgtggaagagaacaggactgaggcccca-----------
A0A096NV05_BCL2L1-      caatttagtgatgtggaagagaacaggactgaggcccca-----------
A0A096MPU7_BCL2-01      gcgggggatggcgcggcgacccctggggcc--gcccccgcaccgggcatc
A0A096NX09_BCL2L2-      -----------------------tggagct--ggccccg-----------
A0A096NX09_BCL2L2-      -----------------------tggagct--ggccccg-----------
                                                    *                     

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      ----------------ggagggcggcttttagctacggagaaggaggcct
A0A2I3LFM0_MCL1-03      ----------------ggagggcggcttttagccac--------------
A0A096NM44_BCL2L10      -------------------------------------------ggaaccc
A0A096NV05_BCL2L1-      -------------------------------------------gaa----
A0A096NV05_BCL2L1-      -------------------------------------------gaa----
A0A096MPU7_BCL2-01      ttctcctcccagcccgggcacacgccccatcccgccgcgtcccgggaccc
A0A096NX09_BCL2L2-      -------------------------------------------ggg----
A0A096NX09_BCL2L2-      -------------------------------------------ggg----
                                                                          

A0A096NMX5_BCL2A1-      ----attgggtccaagca-----------------------aaacgtcca
A0A096NMX5_BCL2A1-      ----attgggtccaagca-----------------------aaacgtcca
A0A2I3LFM0_MCL1-01      cggc-ccggcgagagatagggggaggggaggccggcacggtgattggcgg
A0A2I3LFM0_MCL1-03      cggcgccaaggacacaaagccaatgggcaggtc--------------tgg
A0A096NM44_BCL2L10      -------ggcacc---cctgagccgaggccgtc--------cacgcccga
A0A096NV05_BCL2L1-      -------gggactgaatcggagatggagacccc--------cagtgc---
A0A096NV05_BCL2L1-      -------gggactgaatcggagatggagacccc--------cagtgc---
A0A096MPU7_BCL2-01      ggtcgccaggacc---tcgccgctgccgacccc--------ggctgcccc
A0A096NX09_BCL2L2-      -------agggcc---cagcagctgac-----------------------
A0A096NX09_BCL2L2-      -------agggcc---cagcagctgac-----------------------
                                                                          

A0A096NMX5_BCL2A1-      gagtgctacaaaaggttgcattctca------------------------
A0A096NMX5_BCL2A1-      gagtgctacaaaaggttgcattctca------------------------
A0A2I3LFM0_MCL1-01      aaccgccggcgcaagccccccggccg------------------------
A0A2I3LFM0_MCL1-03      ggccaccagcaggaaggctctgg-ag------------------------
A0A096NM44_BCL2L10      ggccgccgtgc-------tgcgctca------------------------
A0A096NV05_BCL2L1-      --catcaatggcaacccatcct----------------------------
A0A096NV05_BCL2L1-      --catcaatggcaacccatcctggcacctggtggacagccccgcggtgaa
A0A096MPU7_BCL2-01      cgccgccgccgcggggcctgcgctcagcccggtgccacct----------
A0A096NX09_BCL2L2-      --ccgctgcaccaagccatgcgggca------------------------
A0A096NX09_BCL2L2-      --ccgctgcaccaagccatgcgggca------------------------
                             *                                            

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      tggagccactggccacagcagcagtttggatgcccgggaggtgatcccca
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
                                                                          

A0A096NMX5_BCL2A1-      -----------------gtccaaaaagaagtggaaaagaatctgaagcca
A0A096NMX5_BCL2A1-      -----------------gtccaaaaagaagtggaaaagaatctgaagcca
A0A2I3LFM0_MCL1-01      -----------------ccctcacgccagacgcccggagggtcgcgcggc
A0A2I3LFM0_MCL1-03      -----------------accttac----gacgggttggggatggcgtg--
A0A096NM44_BCL2L10      -----------------------------gcagccgccaggttacggcag
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      tggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactg
A0A096MPU7_BCL2-01      -----gtggtccacctgaccctccgccaggccggtgacgacttctcccgc
A0A096NX09_BCL2L2-      -----------------------------gctggagatgagttcgagacc
A0A096NX09_BCL2L2-      -----------------------------gctggagatgagttcgagacc
                                                                          

A0A096NMX5_BCL2A1-      tgcttg-----------------------gacaatgttaat---------
A0A096NMX5_BCL2A1-      tgcttg-----------------------gacaatgttaat---------
A0A2I3LFM0_MCL1-01      cgccgcccattggcgcggaggtccccgacgtcaccgcgacccccgcgagg
A0A2I3LFM0_MCL1-03      -------------------------------cagcgcaa---ccacgaga
A0A096NM44_BCL2L10      ctccac-------------------------cggtccttcttctccg---
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      cggtac-------------------------cggcgggcgttcagtgacc
A0A096MPU7_BCL2-01      cgctac-------------------------cgccgcgacttcgccgaga
A0A096NX09_BCL2L2-      cgcttc-------------------------cggcgcaccttctctgatc
A0A096NX09_BCL2L2-      cgcttc-------------------------cggcgcaccttctctgatc
                                                                          

A0A096NMX5_BCL2A1-      --------------------------------gttgcat----ccataga
A0A096NMX5_BCL2A1-      --------------------------------gttgcat----ccataga
A0A2I3LFM0_MCL1-01      ccgcttttctttgcgcccacccgccgcgcggcgccgcttgaggagatgga
A0A2I3LFM0_MCL1-03      cggccttccaaggca-------------------tgcttcggaaactgga
A0A096NM44_BCL2L10      -------cct----------------------accgcggct-accccggg
A0A096NV05_BCL2L1-      ------------------------------------------------gg
A0A096NV05_BCL2L1-      tgacatccca----------------------gctccacatcaccccagg
A0A096MPU7_BCL2-01      tgtccagcca----------------------gctgcacctgacgccctt
A0A096NX09_BCL2L2-      tggcggctca----------------------gctgcatgtgaccccagg
A0A096NX09_BCL2L2-      tggcggctca----------------------gctgcatgtgaccccagg
                                                                          

A0A096NMX5_BCL2A1-      cactgcc--------agaacacta--------------------------
A0A096NMX5_BCL2A1-      cactgcc--------agaacacta--------------------------
A0A2I3LFM0_MCL1-01      agccccg----gctgccgacgccatcatgtcgcccgaagaggagctggac
A0A2I3LFM0_MCL1-03      catcaaa----aacgaagacgatgtcaaatc-------------------
A0A096NM44_BCL2L10      aaccgcgtcgagctggtggcgc----------------------------
A0A096NV05_BCL2L1-      gacagca------tatcagagc----------------------------
A0A096NV05_BCL2L1-      gacagca------tatcagagc----------------------------
A0A096MPU7_BCL2-01      caccgcg------cggggacgc----------------------------
A0A096NX09_BCL2L2-      ctcagca------cagcaacgc----------------------------
A0A096NX09_BCL2L2-      ctcagca------cagcaacgc----------------------------
                                                                          

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      gggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgct
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
                                                                          

A0A096NMX5_BCL2A1-      ----ttcaatcaagtgatggaaaagga--------------------gtt
A0A096NMX5_BCL2A1-      ----ttcaatcaagtgatggaaaagga--------------------gtt
A0A2I3LFM0_MCL1-01      ggagttggtcggggaatctggtaatagccccagtacggatgggtcactac
A0A2I3LFM0_MCL1-03      ----tttgtc------tcgagtgatggtccatgt-------------ttt
A0A096NM44_BCL2L10      ----t-------gatggcggaggccgtgct-----------------ctc
A0A096NV05_BCL2L1-      ----tttgaacaggtagtgaatga---act-----------------ctt
A0A096NV05_BCL2L1-      ----tttgaacaggtagtgaatga---act-----------------ctt
A0A096MPU7_BCL2-01      ----tttgccacggtggtggagga---gct-----------------ctt
A0A096NX09_BCL2L2-      ----ttcacccaggtctccgatga---act-----------------ttt
A0A096NX09_BCL2L2-      ----ttcacccaggtctccgatga---act-----------------ttt
                            *                                             

A0A096NMX5_BCL2A1-      tgaagatggcatcattaactggggaagaa----------ttgt---aacc
A0A096NMX5_BCL2A1-      tgaagatggcatcattaactggggaagaa----------ttgt---aacc
A0A2I3LFM0_MCL1-01      cctcgacgccgccgccagcagagg-aggaggaggacgagttgtaccggca
A0A2I3LFM0_MCL1-03      cagcgacggcgtaacaaactggggcagga----------ttgt---gact
A0A096NM44_BCL2L10      cgacagccccggccccacctggggcaggg----------tggt---gtcg
A0A096NV05_BCL2L1-      ccggga---tggggtaaactggggtcgca----------ttgt---ggcc
A0A096NV05_BCL2L1-      ccggga---tggggtaaactggggtcgca----------ttgt---ggcc
A0A096MPU7_BCL2-01      caggga---cggggtgaactgggggagga----------tcgt---ggcc
A0A096NX09_BCL2L2-      ccaagg---gggccccaactggggccgcc----------ttgt---agcc
A0A096NX09_BCL2L2-      ccaagg---gggccccaactggggccgcc----------ttgt---agcc
                                        * * * **  *            * **     * 

A0A096NMX5_BCL2A1-      atattt-----------------gcatttgaagg--tattct-catcaag
A0A096NMX5_BCL2A1-      atattt-----------------gcatttgaagg--tattct-catcaag
A0A2I3LFM0_MCL1-01      gtcgctggagattatctcttggtaccttcgggagcaggccaccggcgcca
A0A2I3LFM0_MCL1-03      ctcatt--------tcttttggtgcctttgtggctaaacacttg-----a
A0A096NM44_BCL2L10      ctggtg-----------------accttcgcggg--gacgctgc-tggag
A0A096NV05_BCL2L1-      tttttc-----------------tccttcggcgg--ggcactgtgcgtgg
A0A096NV05_BCL2L1-      tttttc-----------------tccttcggcgg--ggcactgtgcgtgg
A0A096MPU7_BCL2-01      ttcttt-----------------gagttcggtgg--ggtcatgtgtgtgg
A0A096NX09_BCL2L2-      ttcttt-----------------gtctttggggc--tgcactgtgtgctg
A0A096NX09_BCL2L2-      ttcttt-----------------gtctttggggc--tgcactgtgtgctg
                         *                        ** *                    

A0A096NMX5_BCL2A1-      aaacttctacgacagcga-------------------------attgccc
A0A096NMX5_BCL2A1-      aaacttctacgacagcga-------------------------attgccc
A0A2I3LFM0_MCL1-01      aggacacaaagccaatgg-----------------------------gca
A0A2I3LFM0_MCL1-03      agaccataaa-ccaagaa-----------------------------agc
A0A096NM44_BCL2L10      agagagccgc--tggtgacagcctggtggaagaagcggagcttccagccg
A0A096NV05_BCL2L1-      aaagcgtaga--caagga--------------------------------
A0A096NV05_BCL2L1-      aaagcgtaga--caagga--------------------------------
A0A096MPU7_BCL2-01      agagcgtcaa--ccggga--------------------------------
A0A096NX09_BCL2L2-      agagtgtcaa--caagga--------------------------------
A0A096NX09_BCL2L2-      agagtgtcaa--caagga--------------------------------
                        *                                                 

A0A096NMX5_BCL2A1-      cggatgtggatacttataaggagatttcatat------tttgttgctgag
A0A096NMX5_BCL2A1-      cggatgtggatacttataaggagatttcatat------tttgttgctgag
A0A2I3LFM0_MCL1-01      ggtctggggccaccagcaggaaggctctggaga-----cctt------ac
A0A2I3LFM0_MCL1-03      tgcatcgaaccattagcagaaagtatc-acaga-----cgttctcgtaag
A0A096NM44_BCL2L10      cggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggt
A0A096NV05_BCL2L1-      --gatgcaggtattggtgagtcggatcgc---------agcttggatggc
A0A096NV05_BCL2L1-      --gatgcaggtattggtgagtcggatcgc---------agcttggatggc
A0A096MPU7_BCL2-01      --gatgtcgcccctggtggacaacatcgc---------cctgtggatgac
A0A096NX09_BCL2L2-      --gatggaaccactggtgggacaagtgca---------ggagtggatggt
A0A096NX09_BCL2L2-      --gatggaaccactggtgggacaagtgca---------ggagtggatggt
                            *                    *                        

A0A096NMX5_BCL2A1-      ttcataatgaataacacaggagaa----------------tggataaggc
A0A096NMX5_BCL2A1-      ttcataatgaataacacaggagaa----------------tggataaggc
A0A2I3LFM0_MCL1-01      gacgggttggggatggcgtgcagc-----------------gcaaccacg
A0A2I3LFM0_MCL1-03      gacaaaacgggactggc---tagt-----------------taaacaaag
A0A096NM44_BCL2L10      ggccttgctgagctcgcggctcgcggggcagcaccgcgcctggcttcagg
A0A096NV05_BCL2L1-      cacttacctgaatgaccacctaga------------gccttggatccagg
A0A096NV05_BCL2L1-      cacttacctgaatgaccacctaga------------gccttggatccagg
A0A096MPU7_BCL2-01      tgagtacctgaaccggcacctgca------------cacctggatccagg
A0A096NX09_BCL2L2-      ggcctacctggagacgcggctggc------------tgactggatccaca
A0A096NX09_BCL2L2-      ggcctacctggagacgcggctggc------------tgactggatccaca
                                        *                                 

A0A096NMX5_BCL2A1-      aaaacg------gaggctggg-----------------------------
A0A096NMX5_BCL2A1-      aaaacg------gaggct-gg-----------------------------
A0A2I3LFM0_MCL1-01      agacggccttccaaggatggg----------------tttgtggagttct
A0A2I3LFM0_MCL1-03      aggctg--------ggatggg----------------tttgtggagttct
A0A096NM44_BCL2L10      ctcagg------gcggctgggtgagcacgcggcggacaccgggacgcggg
A0A096NV05_BCL2L1-      agaacg------gcggctggg-----at------acttttgtggaactct
A0A096NV05_BCL2L1-      agaacg------gcggctggg-----at------acttttgtggaactct
A0A096MPU7_BCL2-01      ataacg------gaggctggg-----ac------gcctttgtgg------
A0A096NX09_BCL2L2-      gcagtg------ggggctggg-----agctggaagctatcaaagctcgag
A0A096NX09_BCL2L2-      gcagtg------ggggctggg-----cg------gagttcacagctctat
                             *        ** * **                             

A0A096NMX5_BCL2A1-      ----------------ggaaatggc-------------------------
A0A096NMX5_BCL2A1-      ----------------gaaaatggctttgta-------------------
A0A2I3LFM0_MCL1-01      tccatgtagaggacctagaaggtggcatcag-------------------
A0A2I3LFM0_MCL1-03      tccatgtagaggacctagaaggtggcatcag-------------------
A0A096NM44_BCL2L10      gcgggacgggcatccgggaagcgcccacgaggccggcacggatggctttt
A0A096NV05_BCL2L1-      atggg---------------------------------------------
A0A096NV05_BCL2L1-      atggg---------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A096NX09_BCL2L2-      tcagggagatgga---ggaagaagctgagaagcta----aaggagctaca
A0A096NX09_BCL2L2-      acggggacggggccctggaggaggcgcggcgtctg----cgggag-----
                                                                          

A0A096NMX5_BCL2A1-      -----------------------------------------acaat----
A0A096NMX5_BCL2A1-      ----------------------------------------aagaag----
A0A2I3LFM0_MCL1-01      ----------------------------------------aaatgtgc--
A0A2I3LFM0_MCL1-03      ----------------------------------------aaatgtgc--
A0A096NM44_BCL2L10      gtcacttcttcaggagcccctttccgctggctttttggagaaaactgctg
A0A096NV05_BCL2L1-      ----------------------------------------aacaatgc--
A0A096NV05_BCL2L1-      ----------------------------------------aacaatgc--
A0A096MPU7_BCL2-01      ----------------------------------------aactgtacgg
A0A096NX09_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctg
A0A096NX09_BCL2L2-      ----------gggaactgggcatcagtgag----------gacagtgctg
                                                                          

A0A096NMX5_BCL2A1-      -------------------------------cacatgcctatg-ctagta
A0A096NMX5_BCL2A1-      -------------------------------tttgaacctaaatctggct
A0A2I3LFM0_MCL1-01      -------------------------------tgctggcttttg-------
A0A2I3LFM0_MCL1-03      -------------------------------tgctggcttttg-------
A0A096NM44_BCL2L10      atccaggctttcct-----------------ggcatgcttgttagcaaca
A0A096NV05_BCL2L1-      -------------------------------agca-gccgagagccgaaa
A0A096NV05_BCL2L1-      -------------------------------agca-gccgagagccgaaa
A0A096MPU7_BCL2-01      ccccagca-----------------------tgcg-gcctctgtttgatt
A0A096NX09_BCL2L2-      gcccagtgatcatgtccattgaggagaagatggag-gctgatgcccgttc
A0A096NX09_BCL2L2-      ac-----------------------------gggg-gccg----------
                                                             *            

A0A096NMX5_BCL2A1-      gag--tcagtggcccacaagaagaagaa----------------------
A0A096NMX5_BCL2A1-      gga--tgacttttctagaagttacagga----------------------
A0A2I3LFM0_MCL1-01      -----caggtgttgctggagtaggagct----------------------
A0A2I3LFM0_MCL1-03      -----caggtgttgctggagtaggagct----------------------
A0A096NM44_BCL2L10      gccttcggttatctctggacacgattat----------------------
A0A096NV05_BCL2L1-      gggccagg--agcgcttcaaccgctggt----------------------
A0A096NV05_BCL2L1-      gggccagg--agcgcttcaaccgctggt----------------------
A0A096MPU7_BCL2-01      tctcctggctgtctctgaagactctgct----------------------
A0A096NX09_BCL2L2-      catctatgttggcaatgtggactatggtgcaacagcagaagagttggaag
A0A096NX09_BCL2L2-      ---------tggcactgggggccctggt----------------------
                                                                          

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A096NM44_BCL2L10      ----------------------------------------------tatg
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A096NX09_BCL2L2-      ctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgac
A0A096NX09_BCL2L2-      --------------------------------------------------
                                                                          

A0A096NMX5_BCL2A1-      ------aatggcttt-----------------------------------
A0A096NMX5_BCL2A1-      ------aagatctgt-----------------------------------
A0A2I3LFM0_MCL1-01      -ggtttggcatatct-----------------------------------
A0A2I3LFM0_MCL1-03      -ggtttggcatatct-----------------------------------
A0A096NM44_BCL2L10      agttttaacattttt-----------------------------------
A0A096NV05_BCL2L1-      --tcctgacgggcat-----------------------------------
A0A096NV05_BCL2L1-      --tcctgacgggcat-----------------------------------
A0A096MPU7_BCL2-01      cagttt---ggccct-----------------------------------
A0A096NX09_BCL2L2-      aaatttagtggccatcccaaaggatttgcgtatatagagttctcagacaa
A0A096NX09_BCL2L2-      aactgtaggggcctt-----------------------------------
                                      *                                   

A0A096NMX5_BCL2A1-      -----------gtaa-----------------------------------
A0A096NMX5_BCL2A1-      -----------gaaatgctatctctcctgaagcaatactgt---------
A0A2I3LFM0_MCL1-01      -------------aataagatagccttactg-------------------
A0A2I3LFM0_MCL1-03      -------------aataagatag---------------------------
A0A096NM44_BCL2L10      ------------aacccacttctacctgcccaactg--------------
A0A096NV05_BCL2L1-      ------gactgtggccggcgtggttctgctaggctcact-----------
A0A096NV05_BCL2L1-      ------gactgtggccggcgtggttctgctaggctcact-----------
A0A096MPU7_BCL2-01      ------ggtgggagcttgcatcaccctgggtgccta--------------
A0A096NX09_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtccctatttagaggaa
A0A096NX09_BCL2L2-      --------------------------------------------------
                                                                          

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A096NX09_BCL2L2-      ggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A096NX09_BCL2L2-      --------------------------------------------------
                                                                          

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A096NX09_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A096NX09_BCL2L2-      --------------------------------------------------
                                                                          

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096NV05_BCL2L1-      ------------------------------cttcagtcggaaa-------
A0A096NV05_BCL2L1-      ------------------------------cttcagtcggaaa-------
A0A096MPU7_BCL2-01      ------------------------------tctgggccacaag-------
A0A096NX09_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A096NX09_BCL2L2-      ------------------------------ttttgctagcaag-------
                                                                          

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A096NX09_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A096NX09_BCL2L2-      --------------------------------------------------
                                                                          

A0A096NMX5_BCL2A1-      ---
A0A096NMX5_BCL2A1-      tga
A0A2I3LFM0_MCL1-01      taa
A0A2I3LFM0_MCL1-03      ---
A0A096NM44_BCL2L10      tga
A0A096NV05_BCL2L1-      tga
A0A096NV05_BCL2L1-      tga
A0A096MPU7_BCL2-01      tga
A0A096NX09_BCL2L2-      taa
A0A096NX09_BCL2L2-      tga
                           

© 1998-2019