Dataset for CDS BCL-2-like of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A096NMX5_BCL2A1-      atgacagactgtgaatttg------gatatatttacaggctagctcagga
A0A096NMX5_BCL2A1-      atgacagactgtgaatttg------gatatatttacaggctagctcagga
A0A096NM44_BCL2L10      atggctgacccgttgcggg------agcgcaccgagcggctcctggccga
A0A096MPU7_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2I3M3D6_MCL1-01      atg-----------tttggcctcaaaagaaacgcggtaatcggactcaac
A0A2I3M3D6_MCL1-02      atg-----------tttggcctcaaaagaaacgcggtaatcggactcaac
A0A2I3M3D6_MCL1-03      atg-----------tttggcctcaaaagaaacgcggtaatcggactcaac
A0A2I3MUE4_BCL2L2-      atggcgaccccagcctcggcccc---agacacacgggctctggtggcaga
A0A2I3MUE4_BCL2L2-      atggcgaccccagcctcggcccc---agacacacgggctctggtggcaga
                        ***                           *                   

A0A096NMX5_BCL2A1-      ctatttgcagtacgttctgc-----agataccacaacctggattgggt--
A0A096NMX5_BCL2A1-      ctatttgcagtacgttctgc-----agataccacaacctggattgggt--
A0A096NM44_BCL2L10      ctat------------------ctggggtgctgcgcccgggaacccgg--
A0A096MPU7_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggatgcggggg
A0A2I3M3D6_MCL1-01      ctct-----------actgtg-----------------ggggggccgg--
A0A2I3M3D6_MCL1-02      ctct-----------actgtg-----------------ggggggccgg--
A0A2I3M3D6_MCL1-03      ctct-----------actgtg-----------------ggggggccgg--
A0A2I3MUE4_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtctgtggagctgg--
A0A2I3MUE4_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtctgtggagctgg--
                         *                                      *     *   

A0A096NMX5_BCL2A1-      -------------ccaagcaaaacgtccaga-------------------
A0A096NMX5_BCL2A1-      -------------ccaagcaaaacgtccaga-------------------
A0A096NM44_BCL2L10      ----------cacccctgagccgaggccgtc-------------------
A0A096MPU7_BCL2-01      atggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcc
A0A2I3M3D6_MCL1-01      -------------cttggggg-----ccggcagcgg--------------
A0A2I3M3D6_MCL1-02      -------------cttggggg-----ccggcagcgg--------------
A0A2I3M3D6_MCL1-03      -------------cttggggg-----ccggcagcgg--------------
A0A2I3MUE4_BCL2L2-      -------------ccccggggagggcccagcagctg--------------
A0A2I3MUE4_BCL2L2-      -------------ccccggggagggcccagcagctg--------------
                                     *   *        **                      

A0A096NMX5_BCL2A1-      ------------gtgctacaaaaggttgcattct-------------cag
A0A096NMX5_BCL2A1-      ------------gtgctacaaaaggttgcattct-------------cag
A0A096NM44_BCL2L10      -----------cacgcccgaggccgccgtgctgcgctcagcagccgccag
A0A096MPU7_BCL2-01      cagcccgggcacacgccccatcccgccgcgtcccgggacccggtcgccag
A0A2I3M3D6_MCL1-01      ------------cggcgccacccctccggg---aggg----------cgg
A0A2I3M3D6_MCL1-02      ------------cggcgccacccctccggg---aggg----------cgg
A0A2I3M3D6_MCL1-03      ------------cggcgccacccctccggg---aggg----------cgg
A0A2I3MUE4_BCL2L2-      ----------acccgctgcaccaagccatg---cggg----------cag
A0A2I3MUE4_BCL2L2-      ----------acccgctgcaccaagccatg---cggg----------cag
                                      **   *                           * *

A0A096NMX5_BCL2A1-      tccaaaaagaagtggaaaagaatctgaagcca------------------
A0A096NMX5_BCL2A1-      tccaaaaagaagtggaaaagaatctgaagcca------------------
A0A096NM44_BCL2L10      gttacggcagct--------------------------------------
A0A096MPU7_BCL2-01      gacctcgccgctgccgaccccggctgcccccg------------------
A0A2I3M3D6_MCL1-01      cttttagctacggagaaggaggcctcggcccggcgagagatagggggagg
A0A2I3M3D6_MCL1-02      cttttagctacggagaaggaggcctcggcccggcgagagatagggggagg
A0A2I3M3D6_MCL1-03      ctttta--------------------------------------------
A0A2I3MUE4_BCL2L2-      ct----------ggagatgagttcgagacccg------------------
A0A2I3MUE4_BCL2L2-      ct----------ggagatgagttcgagacccg------------------

A0A096NMX5_BCL2A1-      ---------------------------tgcttggacaatgttaatgttg-
A0A096NMX5_BCL2A1-      ---------------------------tgcttggacaatgttaatgttg-
A0A096NM44_BCL2L10      --------------------------ccaccggtccttcttctccgccta
A0A096MPU7_BCL2-01      --------------------------ccgccgccgcggggcctgcgctca
A0A2I3M3D6_MCL1-01      ggaggccggcacggtgattggcggaaccgccggcgcaagccccccggccg
A0A2I3M3D6_MCL1-02      ggaggccggcacggtgattggcggaaccgccggcgcaagccccccggccg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------cttccggcgcaccttctctgatc-
A0A2I3MUE4_BCL2L2-      --------------------------cttccggcgcaccttctctgatc-

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      ---------------------ccgcggct---------------------
A0A096MPU7_BCL2-01      gcccggtgccac---------ctgtggtccacctgaccctccgccaggcc
A0A2I3M3D6_MCL1-01      ccctcacgccagacgcccggagggtcgcgcggccg-ccgcccattggcgc
A0A2I3M3D6_MCL1-02      ccctcacgccagacgcccggagggtcgcgcggccg-ccgcccattggcgc
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      ---------------------tggcggctcagctg-c-------------
A0A2I3MUE4_BCL2L2-      ---------------------tggcggctcagctg-c-------------

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096MPU7_BCL2-01      ggtgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccag
A0A2I3M3D6_MCL1-01      ggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctt-----
A0A2I3M3D6_MCL1-02      ggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctt-----
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      ------------------------------------------atg-----
A0A2I3MUE4_BCL2L2-      ------------------------------------------atg-----

A0A096NMX5_BCL2A1-      -----------catccatagacactgccagaacactattca---------
A0A096NMX5_BCL2A1-      -----------catccatagacactgccagaacactattca---------
A0A096NM44_BCL2L10      -------------accccgggaaccgcgtcgagctggtgg----------
A0A096MPU7_BCL2-01      ccagctgcacctgacgcccttcaccgcgcggggacgctttg---------
A0A2I3M3D6_MCL1-01      -----------tgcgcccacccgccgcgcggcgccgcttgaggagatgga
A0A2I3M3D6_MCL1-02      -----------tgcgcccacccgccgcgcggcgccgcttgaggagatgga
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      -----------tgaccccaggctcagcacagcaacgcttca---------
A0A2I3MUE4_BCL2L2-      -----------tgaccccaggctcagcacagcaacgcttca---------

A0A096NMX5_BCL2A1-      --atcaagtgatggaaa-----aggagtttgaagatggcatcattaactg
A0A096NMX5_BCL2A1-      --atcaagtgatggaaa-----aggagtttgaagatggcatcattaactg
A0A096NM44_BCL2L10      --cgctgatggcggaggccg--tgctctccgacagccccggccccacctg
A0A096MPU7_BCL2-01      --ccacggtggtggagg-----agctcttcaggga---cggggtgaactg
A0A2I3M3D6_MCL1-01      agccccggctgccgacgccatcatgtcgcccgaag---aggagctggacg
A0A2I3M3D6_MCL1-02      agccccggctgccgacgccatcatgtcgcccgaag---aggagctggacg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --cccaggtctccgatg-----aacttttccaagg---gggccccaactg
A0A2I3MUE4_BCL2L2-      --cccaggtctccgatg-----aacttttccaagg---gggccccaactg

A0A096NMX5_BCL2A1-      gggaagaattgtaaccatat-------------ttgcatt----------
A0A096NMX5_BCL2A1-      gggaagaattgtaaccatat-------------ttgcatt----------
A0A096NM44_BCL2L10      gggcagggtggtgtcgctgg-------------tgacctt--------cg
A0A096MPU7_BCL2-01      ggggaggatcgtggccttct-------------ttgagtt--------cg
A0A2I3M3D6_MCL1-01      ggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctg
A0A2I3M3D6_MCL1-02      ggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctg
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      gggccgccttgtagccttct-------------ttgtctt--------tg
A0A2I3MUE4_BCL2L2-      gggccgccttgtagccttct-------------ttgtctt--------tg

A0A096NMX5_BCL2A1-      -----------------tgaaggtattctcatcaagaaacttctac----
A0A096NMX5_BCL2A1-      -----------------tgaaggtattctcatcaagaaacttctac----
A0A096NM44_BCL2L10      cggggacgctgc-----tggagagagagccgctggtgaca----------
A0A096MPU7_BCL2-01      gtggggtcatgtg----tgtggagagcgtcaaccgggagatgtcgc----
A0A2I3M3D6_MCL1-01      gagttggtcggggaatctggtaatagccccagtacggatgggtcactacc
A0A2I3M3D6_MCL1-02      gagttggtcggggaatctggtaatagccccagtacggatgggtcactacc
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      gggctgcactgtg----tgctgagagtgtcaacaaggagatggaac----
A0A2I3MUE4_BCL2L2-      gggctgcactgtg----tgctgagagtgtcaacaaggagatggaac----

A0A096NMX5_BCL2A1-      ------------------------------gacagcgaattgcc------
A0A096NMX5_BCL2A1-      ------------------------------gacagcgaattgcc------
A0A096NM44_BCL2L10      -----gcctggtggaagaagcggagcttccagccgcgg-----ctgaagg
A0A096MPU7_BCL2-01      -----ccctggtggacaacatcgccctgtggatgactgagtacctgaacc
A0A2I3M3D6_MCL1-01      ctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagt
A0A2I3M3D6_MCL1-02      ctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagt
A0A2I3M3D6_MCL1-03      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      -----cactggtgggacaagtgcaggagtggatggtggcctacctggaga
A0A2I3MUE4_BCL2L2-      -----cactggtgggacaagtgcaggagtggatggtggcctacctggaga

A0A096NMX5_BCL2A1-      -----ccggatgt------ggatacttataaggagatttcatattttgtt
A0A096NMX5_BCL2A1-      -----ccggatgt------ggatacttataaggagatttcatattttgtt
A0A096NM44_BCL2L10      agcaggagggcgacg----tcgcccgggactgccagcgcctggtggcctt
A0A096MPU7_BCL2-01      ggcacctgcacacct----ggatccaggataacggaggctggg-------
A0A2I3M3D6_MCL1-01      cgctggagattatctcttggtaccttcgggagcaggccaccggcg--cc-
A0A2I3M3D6_MCL1-02      cgctggagattatctcttggtaccttcgggagcaggccaccggcg--cc-
A0A2I3M3D6_MCL1-03      -----------------------------------gccaccggcg--cc-
A0A2I3MUE4_BCL2L2-      cgcggctggctgact----ggatccacagcagtgggggctgggcg-----
A0A2I3MUE4_BCL2L2-      cgcggctggctgact----ggatccacagcagtgggggctgggag--ctg

A0A096NMX5_BCL2A1-      gctgagttcataatgaataacacaggagaa---------tggataaggca
A0A096NMX5_BCL2A1-      gctgagttcataatgaataacacaggagaa---------tggataaggca
A0A096NM44_BCL2L10      gctgagctcgcggct-----cgcggggcagcaccgcgcctggcttcaggc
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3M3D6_MCL1-01      -aaggacacaaagc------caatgggcag------gtctggggccacca
A0A2I3M3D6_MCL1-02      -aaggacacaaagc------caatgggcag------gtctggggccacca
A0A2I3M3D6_MCL1-03      -aaggacacaaagc------caatgggcag------gtctggggccacca
A0A2I3MUE4_BCL2L2-      ---gagttcacagctctatacggggacggg------gccctggagga--g
A0A2I3MUE4_BCL2L2-      gaagctatcaaagctcgagtcagggagatg------ga---ggaaga--a

A0A096NMX5_BCL2A1-      aaacggaggct-gggaaa-------atggctttgtaaagaagtttgaacc
A0A096NMX5_BCL2A1-      aaacggaggctgggggaa-------atggc-------acaatcacatgcc
A0A096NM44_BCL2L10      tcagggcggctgggtgagcacgcggcggacaccgggacgcggggcgggac
A0A096MPU7_BCL2-01      -------------------------acgcctttgtggaactgtacggccc
A0A2I3M3D6_MCL1-01      gcaggaaggctctggagaccttacgacgggttggggatggcgtgcagcgc
A0A2I3M3D6_MCL1-02      gcaggaaggctctggagaccttacgacgggttggggatggcgtgcagcgc
A0A2I3M3D6_MCL1-03      gcaggaaggctctggagaccttacgacgggttggggatggcgtgcagcgc
A0A2I3MUE4_BCL2L2-      gcgcggcgtctgcgggag---------------ggga------actgggc
A0A2I3MUE4_BCL2L2-      gctgagaagctaaaggagctacagaacgaggtagaga------agcagat

A0A096NMX5_BCL2A1-      taaatctggctggatgacttttctagaag---------------------
A0A096NMX5_BCL2A1-      tatg-ctagtagagtcagtggcccacaag---------------------
A0A096NM44_BCL2L10      gggc----atccgggaagcgcc-cacgaggccggcacg------------
A0A096MPU7_BCL2-01      cagc----atgcggcctctgtt----------------------------
A0A2I3M3D6_MCL1-01      aacc----acgagacggccttc---caa----------------------
A0A2I3M3D6_MCL1-02      aacc----acgagacggccttc---caaggcatgcttcggaaactggaca
A0A2I3M3D6_MCL1-03      aacc----acgagacggccttc---caaggcatgcttcggaaactggaca
A0A2I3MUE4_BCL2L2-      atca----gtgag----------gacagtgctgac---------------
A0A2I3MUE4_BCL2L2-      gaat----atgagtccacctccaggcaatgctggcccagtgatcatgtcc

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      --------------gatggcttttgtcacttct-----------------
A0A096MPU7_BCL2-01      -------------tgatttctcctggctgtctc-----------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-02      tcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgtt
A0A2I3M3D6_MCL1-03      tcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgtt
A0A2I3MUE4_BCL2L2-      --------------gggggccg---------------------------t
A0A2I3MUE4_BCL2L2-      attgaggagaagatggaggctgatgcccgttcc--------atctatgtt

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-02      ttcagcgacggc-gtaacaaactggggcaggattgtgactctcatttctt
A0A2I3M3D6_MCL1-03      ttcagcgacggc-gtaacaaactggggcaggattgtgactctcatttctt
A0A2I3MUE4_BCL2L2-      ggcactgggggccctggt--------------------------------
A0A2I3MUE4_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagttggaagctca----ct

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      ------------------------------------------------tc
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-02      ttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgc
A0A2I3M3D6_MCL1-03      ttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgc
A0A2I3MUE4_BCL2L2-      --------------------------------------------aactgt
A0A2I3MUE4_BCL2L2-      ttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaattt

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      aggagcccctt---------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3M3D6_MCL1-01      --------------------------------------------------
A0A2I3M3D6_MCL1-02      atcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacg
A0A2I3M3D6_MCL1-03      atcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacg
A0A2I3MUE4_BCL2L2-      aggggcc-------------------------tt----------------
A0A2I3MUE4_BCL2L2-      agtggcc-------------------------atcccaaaggatttgcgt

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      ----------------------------------tccgctggctt-----
A0A096MPU7_BCL2-01      ---------------------------tgaagactctgctcagtt-----
A0A2I3M3D6_MCL1-01      ---------------------------ggatgggtttgtggagtt-----
A0A2I3M3D6_MCL1-02      ggactggctagttaaacaaagaggctgggatgggtttgtggagtt-----
A0A2I3M3D6_MCL1-03      ggactggctagttaaacaaagaggctgggatgggtttgtggagtt-----
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccttggccttagat

A0A096NMX5_BCL2A1-      --------ttacaggaaa--------------------------------
A0A096NMX5_BCL2A1-      --------aagaagaaaa--------------------------------
A0A096NM44_BCL2L10      -------tttggagaaaactgctgatccaggctttcctggcatgcttgtt
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3M3D6_MCL1-01      ---cttccatgtagagga-----------------cctagaagg-----t
A0A2I3M3D6_MCL1-02      ---cttccatgtagagga-----------------cctagaagg-----t
A0A2I3M3D6_MCL1-03      ---cttccatgtagagga-----------------cctagaagg-----t
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      gagtccctatttagaggaaggcaaatcaaggtgatcccaaaacg-----a

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      agcaacagc-----------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3M3D6_MCL1-01      ggcatcaga-----------------------------------------
A0A2I3M3D6_MCL1-02      ggcatcaga-----------------------------------------
A0A2I3M3D6_MCL1-03      ggcatcaga-----------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      accaacagaccaggcatcagcacaacagaccggggttttccacgagcccg

A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------cttcgg
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3M3D6_MCL1-01      -----------------------------------------aatgtgctg
A0A2I3M3D6_MCL1-02      -----------------------------------------aatgtgctg
A0A2I3M3D6_MCL1-03      -----------------------------------------aatgtgctg
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctaca

A0A096NMX5_BCL2A1-      -gatctgtgaaatgctatctctcctgaagcaatactgt------------
A0A096NMX5_BCL2A1-      -tggctttgtaa--------------------------------------
A0A096NM44_BCL2L10      ttatctctggacacgattattatgagttttaacatttttaacccacttct
A0A096MPU7_BCL2-01      -tggccctggtgggagcttgcatcaccctgggt-------------gcct
A0A2I3M3D6_MCL1-01      ctggcttttgcaggtgtt-------gctggagtaggagctggtttggcat
A0A2I3M3D6_MCL1-02      ctggcttttgcaggtgtt-------gctggagtaggagctggtttggcat
A0A2I3M3D6_MCL1-03      ctggcttttgcaggtgtt-------gctggagtaggagctggtttggcat
A0A2I3MUE4_BCL2L2-      ----ttttgctagcaag---------------------------------
A0A2I3MUE4_BCL2L2-      gtggttttaacagcaggc-------cccggggtcgtgtctacaggggccg

A0A096NMX5_BCL2A1-      -------------------------------tga
A0A096NMX5_BCL2A1-      ----------------------------------
A0A096NM44_BCL2L10      acctgcccaactg------------------tga
A0A096MPU7_BCL2-01      atctgggccacaag-----------------tga
A0A2I3M3D6_MCL1-01      atctaataagatagccttactg---------taa
A0A2I3M3D6_MCL1-02      atctaataagatag--------------------
A0A2I3M3D6_MCL1-03      atctaataagatag--------------------
A0A2I3MUE4_BCL2L2-      -------------------------------tga
A0A2I3MUE4_BCL2L2-      ggctagagcgacatcatggtattccccttactaa

© 1998-2019