Dataset for CDS BCL2A1 of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096NMX5_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactattt
A0A096NMX5_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactattt
                        **************************************************

A0A096NMX5_BCL2A1-      gcagtacgttctgcagataccacaacctggattgggtccaagcaaaacgt
A0A096NMX5_BCL2A1-      gcagtacgttctgcagataccacaacctggattgggtccaagcaaaacgt
                        **************************************************

A0A096NMX5_BCL2A1-      ccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag
A0A096NMX5_BCL2A1-      ccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag
                        **************************************************

A0A096NMX5_BCL2A1-      aatctgaagccatgcttggacaatgttaatgttgcatccatagacactgc
A0A096NMX5_BCL2A1-      aatctgaagccatgcttggacaatgttaatgttgcatccatagacactgc
                        **************************************************

A0A096NMX5_BCL2A1-      cagaacactattcaatcaagtgatggaaaaggagtttgaagatggcatca
A0A096NMX5_BCL2A1-      cagaacactattcaatcaagtgatggaaaaggagtttgaagatggcatca
                        **************************************************

A0A096NMX5_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A096NMX5_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                        **************************************************

A0A096NMX5_BCL2A1-      aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
A0A096NMX5_BCL2A1-      aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
                        **************************************************

A0A096NMX5_BCL2A1-      gatttcatattttgttgctgagttcataatgaataacacaggagaatgga
A0A096NMX5_BCL2A1-      gatttcatattttgttgctgagttcataatgaataacacaggagaatgga
                        **************************************************

A0A096NMX5_BCL2A1-      taaggcaaaacggaggctgggggaaatggc-------acaatcacatgcc
A0A096NMX5_BCL2A1-      taaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
                        ****************** *** *******       * **       **

A0A096NMX5_BCL2A1-      tatg-ctagtagagtcagtggcccacaagaagaagaaaatggctttgtaa
A0A096NMX5_BCL2A1-      taaatctggctggatgacttttctagaagttacaggaaagatctgtgaaa
                        **   ** *  *  * * *   * * ***    ** ***   ** ** **

A0A096NMX5_BCL2A1-      -----------------------------
A0A096NMX5_BCL2A1-      tgctatctctcctgaagcaatactgttga
                                                     

© 1998-2018