Dataset for CDS MCL-1 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G2HFR3_MCL1-01      atggacatttgccggctctcagcagcaatgcgtgaatttta-------------------
K7DE58_MCL1-04      ---agtgtt---------------gaaacgtg----------------------------
K7DE58_MCL1-02      ----atgtttggc----ctcaaaagaaacgcggtaatcggactcaacctctactgtgggg
K7DE58_MCL1-01      ----atgtttggc----ctcaaaagaaacgcggtaatcggactcaacctctactgtgggg
K7DE58_MCL1-03      ----atgtttggc----ctcaaaagaaacgcggtaatcggactcaacctctactgtgggg
                           **               * ** * *                            

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      gggccggcttgggggccggcagcggcggcgccacccctccgggagggcgacttttggcta
K7DE58_MCL1-01      gggccggcttgggggccggcagcggcggcgccacccctccgggagggcgacttttggcta
K7DE58_MCL1-03      gggccggcttgggggccggcagcggcggcgccacccctccgggagggcgactttt-----
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      cggagaaggaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattg
K7DE58_MCL1-01      cggagaaggaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattg
K7DE58_MCL1-03      ------------------------------------------------------------
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      gcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgc
K7DE58_MCL1-01      gcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgc
K7DE58_MCL1-03      ------------------------------------------------------------
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      ggccgccgcccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttt
K7DE58_MCL1-01      ggccgccgcccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttt
K7DE58_MCL1-03      ------------------------------------------------------------
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      tcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacg
K7DE58_MCL1-01      tcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacg
K7DE58_MCL1-03      ------------------------------------------------------------
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      ccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggc
K7DE58_MCL1-01      ccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggc
K7DE58_MCL1-03      ------------------------------------------------------------
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      cggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacg
K7DE58_MCL1-01      cggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacg
K7DE58_MCL1-03      ------------------------------------------------------------
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      ggtcactaccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagt
K7DE58_MCL1-01      ggtcactaccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagt
K7DE58_MCL1-03      ------------------------------------------------------------
                                                                                

G2HFR3_MCL1-01      ------------------------------------------------------------
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      ccctggagattatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagc
K7DE58_MCL1-01      ccctggagattatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagc
K7DE58_MCL1-03      ----------------------------------ggccaccggcgccaaggacacaaagc
                                                                                

G2HFR3_MCL1-01      cattgtgca-------------------------tctggatatatacccaccacctgagt
K7DE58_MCL1-04      ------------------------------------------------------------
K7DE58_MCL1-02      caatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
K7DE58_MCL1-01      caatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
K7DE58_MCL1-03      caatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgggg
                                                                                

G2HFR3_MCL1-01      gtaccattca---------------------------catgtt------actggacatca
K7DE58_MCL1-04      -------------------------------------catgcttcggaaactggacatca
K7DE58_MCL1-02      atggcgtgcagcgcaaccatgagacggccttccaa-------------------------
K7DE58_MCL1-01      atggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatca
K7DE58_MCL1-03      atggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatca
                                                                                

G2HFR3_MCL1-01      aaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcg
K7DE58_MCL1-04      aaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcg
K7DE58_MCL1-02      ------------------------------------------------------------
K7DE58_MCL1-01      aaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcg
K7DE58_MCL1-03      aaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcg
                                                                                

G2HFR3_MCL1-01      taacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacact
K7DE58_MCL1-04      taacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacact
K7DE58_MCL1-02      ------------------------------------------------------------
K7DE58_MCL1-01      taacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacact
K7DE58_MCL1-03      taacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacact
                                                                                

G2HFR3_MCL1-01      tgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
K7DE58_MCL1-04      tgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
K7DE58_MCL1-02      ------------------------------------------------------------
K7DE58_MCL1-01      tgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
K7DE58_MCL1-03      tgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
                                                                                

G2HFR3_MCL1-01      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagt
K7DE58_MCL1-04      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagt
K7DE58_MCL1-02      -------------------------------------------ggatgggtttgtggagt
K7DE58_MCL1-01      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagt
K7DE58_MCL1-03      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagt
                                                               *****************

G2HFR3_MCL1-01      tcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtg
K7DE58_MCL1-04      tcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtg
K7DE58_MCL1-02      tcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtg
K7DE58_MCL1-01      tcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtg
K7DE58_MCL1-03      tcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtg
                    ************************************************************

G2HFR3_MCL1-01      ttgctggagtaggagctggtttggcatatctaataagatag-----------
K7DE58_MCL1-04      ttgctggagtaggagctggtttggcatatctaataagatag-----------
K7DE58_MCL1-02      ttgctggagtaggagctggtttggcatatctaataagatagccttactgtaa
K7DE58_MCL1-01      ttgctggagtaggagctggtttggcatatctaataagatag-----------
K7DE58_MCL1-03      ttgctggagtaggagctggtttggcatatctaataagatag-----------
                    *****************************************           

© 1998-2018