Dataset for CDS BCL-2-like of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2Q805_BCL2L2-01        atggcgacccc----agcctcagccccagacacacgggctctggtggcag
H2Q805_BCL2L2-02        atggcgacccc----agcctcagccccagacacacgggctctggtggcag
H2QEM8_BCL2-01          atggcgcacgctgggag-aacagggtacgataaccgggagatagtgatga
H2Q9G4_BCL2L10-01       atggttgacc--------agtggcgt-----------------------g
G2HFR3_MCL1-01          atg-----------------------------------------------
A0A2I3RTV4_MCL1-03      atgtttggcctcaaaagaaacgcggt-----------------------a
A0A2I3RTV4_MCL1-01      atgtttggcctcaaaagaaacgcggt-----------------------a
                        ***                                               

H2Q805_BCL2L2-01        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
H2Q805_BCL2L2-02        actttgtaggttataagctgaggcagaagggttatgtctgtggagctggc
H2QEM8_BCL2-01          agtacatccattataagctgtcgcagaggggctacgagtgggatgcggga
H2Q9G4_BCL2L10-01       agcgcacc-accat---------------ggc--cgaccc--------gc
G2HFR3_MCL1-01          ---------gacat---tt-----------gc--cggctc--------tc
A0A2I3RTV4_MCL1-03      atcggactcaacct---ctactgtgggggggc--cggcttgggggccggc
A0A2I3RTV4_MCL1-01      atcggactcaacct---ctactgtgggggggc--cggcttgggggccggc
                                     *                *    *              

H2Q805_BCL2L2-01        cccggggagggccc-------------------------agcagct----
H2Q805_BCL2L2-02        cccggggagggccc-------------------------agcagct----
H2QEM8_BCL2-01          gatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttct-
H2Q9G4_BCL2L10-01       tgcgggagcgcacc------------------------gagcggttgctg
G2HFR3_MCL1-01          agcagcaatgc-----------------------------gtgaatttt-
A0A2I3RTV4_MCL1-03      agcggcggcgccacccctccggga--------------gggcgactttt-
A0A2I3RTV4_MCL1-01      agcggcggcgccacccctccggga--------------gggcgacttttg
                                 *                              *    *    

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          -cctcccagcccgggcacacgccccatccagccgca--------------
H2Q9G4_BCL2L10-01       gccgactacctggggtactgcgcccg------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      gctacggagaaggaggcctcggcccggcgagagatagggggaggggaggc
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      cggcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctca
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      cgccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtc
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      cccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccg
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      ccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatca
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      tgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaag
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      cggccggctgtcctgcctctgctggagttggtcggggaatctggtaataa
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      caccagtacggacgggtcactaccctcgacgccgccgccagcagaggagg
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          -----------------------------------------------tcc
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      aggaggacgagttgtaccggcagtccctggagattatctctcggtacctt
                                                                          

H2Q805_BCL2L2-01        --------gacccgctgcaccaa---------------------------
H2Q805_BCL2L2-02        --------gacccgctgcaccaa---------------------------
H2QEM8_BCL2-01          cgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccgg
H2Q9G4_BCL2L10-01       --------ggaacccggcacccccgagccgacgcc---gtccacgcccga
G2HFR3_MCL1-01          ---------------------------------acattgtgca-------
A0A2I3RTV4_MCL1-03      --------ggccaccggcgccaaggacacaaagccaatgggcaggtctgg
A0A2I3RTV4_MCL1-01      cgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctgg
                                                                          

H2Q805_BCL2L2-01        -------------------------------------------------g
H2Q805_BCL2L2-02        -------------------------------------------------g
H2QEM8_BCL2-01          cgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctga
H2Q9G4_BCL2L10-01       ggccgcc---------gtgctg--c------------------------g
G2HFR3_MCL1-01          ------------------tctggat------------------------a
A0A2I3RTV4_MCL1-03      ggccaccagcaggaaggcgctggag------------------------a
A0A2I3RTV4_MCL1-01      ggccaccagcaggaaggcgctggag------------------------a
                                                                          

H2Q805_BCL2L2-01        ccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttc
H2Q805_BCL2L2-02        ccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttc
H2QEM8_BCL2-01          ccctccgccaggccggcgacgacttctcccgccgctaccgccgcgacttc
H2Q9G4_BCL2L10-01       ctccgcggccgccaggttacggca-------gatccaccggtccttcttc
G2HFR3_MCL1-01          tatacccaccacctgagtgtaccattca----------------------
A0A2I3RTV4_MCL1-03      ccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttc
A0A2I3RTV4_MCL1-01      ccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttc
                             *        *                                   

H2Q805_BCL2L2-01        tctgatctggcggctcagctgcatgtgacc-ccaggctcagcccaacaac
H2Q805_BCL2L2-02        tctgatctggcggctcagctgcatgtgacc-ccaggctcagcccaacaac
H2QEM8_BCL2-01          gccgagatgtccagccagctgcacctgacg-cccttcaccgcgcggggac
H2Q9G4_BCL2L10-01       tccg-cctacctcggctacc-----------ccgggaaccgcttcgagct
G2HFR3_MCL1-01          -----catgtt------actggacatcaaaaacgaagacgatgtgaaatc
A0A2I3RTV4_MCL1-03      caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
A0A2I3RTV4_MCL1-01      caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
                               *          *             *     *           

H2Q805_BCL2L2-01        gcttcacccaggtctccgat---gaacttttt--caagggggccccaa--
H2Q805_BCL2L2-02        gcttcacccaggtctccgat---gaacttttt--caagggggccccaa--
H2QEM8_BCL2-01          gctttgccacggtggtggag---gagctctt---cagggacggggtgaa-
H2Q9G4_BCL2L10-01       g-gtggcgctgatggcggattccgtgctctccgacagccccggccccac-
G2HFR3_MCL1-01          g-ttgtctcgagtgatga--tccatgtttt----cagcgacggcgtaaca
A0A2I3RTV4_MCL1-03      g-ttgtctcgagtgatga--tccatgtttt----cagcgacggcgtaaca
A0A2I3RTV4_MCL1-01      g-ttgtctcgagtgatga--tccatgtttt----cagcgacggcgtaaca
                        *  *  *     *              * *    **     *     *  

H2Q805_BCL2L2-01        --ctggggccgccttgtagccttctttgtctttgggg-------------
H2Q805_BCL2L2-02        --ctggggccgccttgtagccttctttgtctttgggg-------------
H2QEM8_BCL2-01          --ctgggggaggattgtggccttctttgagttcggtg-------------
H2Q9G4_BCL2L10-01       --ctggggcagagtggtgacgctcgtgaccttcgcagggacgctgctgga
G2HFR3_MCL1-01          aactggggcaggattgtgactctcatttcttttg----------------
A0A2I3RTV4_MCL1-03      aactggggcaggattgtgactctcatttcttttg----------------
A0A2I3RTV4_MCL1-01      aactggggcaggattgtgactctcatttcttttg----------------
                          ******  *  * **  *  ** *    ** *                

H2Q805_BCL2L2-01        ----ctgcactgtgtg----------ctgaga------gtgtcaa-----
H2Q805_BCL2L2-02        ----ctgcactgtgtg----------ctgaga------gtgtcaa-----
H2QEM8_BCL2-01          ----gggtcatgtgtg----------tggaga------gcgtcaa-----
H2Q9G4_BCL2L10-01       gagagggccgctggtgaccacccggtggaagaagtggggcttccagccgc
G2HFR3_MCL1-01          ----gtgcc-tttgtggctaaacacttgaaga----------cca-----
A0A2I3RTV4_MCL1-03      ----gtgcc-tttgtggctaaacacttgaaga----------cca-----
A0A2I3RTV4_MCL1-01      ----gtgcc-tttgtggctaaacacttgaaga----------cca-----
                              *      ***             ***          * *     

H2Q805_BCL2L2-01        -----------caaggagatggaaccactggtgggacaagtgcaggagtg
H2Q805_BCL2L2-02        -----------caaggagatggaaccactggtgggacaagtgcaggagtg
H2QEM8_BCL2-01          -----------ccgggagatgtcgcccctggtgg-------acaacatcg
H2Q9G4_BCL2L10-01       ggctaaatgagcaggagggcgacgtcgcccggga-------ctgccagcg
G2HFR3_MCL1-01          ---taaac---caagaaagctgcatc-----gaa-------ccattagca
A0A2I3RTV4_MCL1-03      ---taaac---caagaaagctgcatc-----gaa-------ccattagca
A0A2I3RTV4_MCL1-01      ---taaac---caagaaagctgcatc-----gaa-------ccattagca
                                   *  *          *                    *   

H2Q805_BCL2L2-01        gatggtggcctacctggagacgcggctggc------------tgactgga
H2Q805_BCL2L2-02        gatggtggcctacctggagacgcggctggc------------tgactgga
H2QEM8_BCL2-01          ccctgtgg-atgactgagtac----ctgaaccggcacctgcacacctgga
H2Q9G4_BCL2L10-01       cctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggc
G2HFR3_MCL1-01          ---gaaagtatcacagacgtt----ctcgtaaggacaaaacgggactggc
A0A2I3RTV4_MCL1-03      ---gaaagtatcacagacgtt----ctcgtaaggacaaaacgggactggc
A0A2I3RTV4_MCL1-01      ---gaaagtatcacagacgtt----ctcgtaaggacaaaacgggactggc
                               *  *  * *         **                  **** 

H2Q805_BCL2L2-01        tccacagcagtgggggctgggcg------gagttcacagctctatacggg
H2Q805_BCL2L2-02        tccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagg
H2QEM8_BCL2-01          tccaggataacggaggctgggat------gcctttgtggaactgtac---
H2Q9G4_BCL2L10-01       tgcaggctcagggcggctgggat------ggcttttgtcacttcttc---
G2HFR3_MCL1-01          tagttaaacaaagaggctgggat------gggtttgtggagttcttccat
A0A2I3RTV4_MCL1-03      tagttaaacaaagaggctgggat------gggtttgtggagttcttccat
A0A2I3RTV4_MCL1-01      tagttaaacaaagaggctgggat------gggtttgtggagttcttccat
                        *           * *******        *   *            *   

H2Q805_BCL2L2-01        gacggggc---cctggaggaggcgcggcgtctgcgggag-----------
H2Q805_BCL2L2-02        gagatgga------ggaagaagctgagaagctaaaggagctacagaacga
H2QEM8_BCL2-01          -----ggc---ccc------------------------------------
H2Q9G4_BCL2L10-01       ----aggaccccct------------------------------------
G2HFR3_MCL1-01          gtagagga---cct------------------------------------
A0A2I3RTV4_MCL1-03      gtagagga---cct------------------------------------
A0A2I3RTV4_MCL1-01      gtagagga---cct------------------------------------
                             **                                           

H2Q805_BCL2L2-01        ----gggaactgggcatcagtgag----------gacagtgctgac----
H2Q805_BCL2L2-02        ggtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccag
H2QEM8_BCL2-01          -----agcatgcggcctctgtttg----------atttctcctggc----
H2Q9G4_BCL2L10-01       -----ttccgctggctttttggag----------aaaacagctggt----
G2HFR3_MCL1-01          -----agaaggtggcatc----ag----------gaatgtgctg------
A0A2I3RTV4_MCL1-03      -----agaaggtggcatc----ag----------gaatgtgctg------
A0A2I3RTV4_MCL1-01      -----agaaggtggcatc----ag----------gaatgtgctg------
                                    *          *                 ***      

H2Q805_BCL2L2-01        -------------------------gggggccg-----------------
H2Q805_BCL2L2-02        tgatcatgtccattgaggagaagatggaggctgatgcccgttccatctat
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
                                                                          

H2Q805_BCL2L2-01        --tggcactgggggccctggt-----------------------------
H2Q805_BCL2L2-02        gttggcaatgtggactatggtgcaacagcagaagagctggaagctcactt
H2QEM8_BCL2-01          --tgtctctgaagactctgct-----------------------------
H2Q9G4_BCL2L10-01       --cca-------ggcttttct-----------------------------
G2HFR3_MCL1-01          ---ct-------ggcttttgc-----------------------------
A0A2I3RTV4_MCL1-03      ---ct-------ggcttttgc-----------------------------
A0A2I3RTV4_MCL1-01      ---ct-------ggcttttgc-----------------------------
                                    * *  *                                

H2Q805_BCL2L2-01        -------------------------------------------aactgta
H2Q805_BCL2L2-02        tcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaattta
H2QEM8_BCL2-01          -------------------------------------------cagtttg
H2Q9G4_BCL2L10-01       ---------------------------------------------gtcat
G2HFR3_MCL1-01          -------------------------------------------aggtgtt
A0A2I3RTV4_MCL1-03      -------------------------------------------aggtgtt
A0A2I3RTV4_MCL1-01      -------------------------------------------aggtgtt
                                                                      *   

H2Q805_BCL2L2-01        ggggcctt------------------------------------------
H2Q805_BCL2L2-02        gtggccatcccaaagggtttgcgtatatagagttctcagacaaagagtca
H2QEM8_BCL2-01          gccc----------------------------------------------
H2Q9G4_BCL2L10-01       gctt----------------------------------------------
G2HFR3_MCL1-01          gctg----------------------------------------------
A0A2I3RTV4_MCL1-03      gctg----------------------------------------------
A0A2I3RTV4_MCL1-01      gctg----------------------------------------------
                        *                                                 

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        gtgaggacttccttggccttagatgagtccctatttagaggaaggcaaat
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        caaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagacc
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
                                                                          

H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        ggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagt
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
                                                                          

H2Q805_BCL2L2-01        -----------------------ttttgctagcaag--------------
H2Q805_BCL2L2-02        tcccgctctcgattctacagtggttttaacagcaggcccc---ggggtcg
H2QEM8_BCL2-01          -----------------------tggtgggagcttgcatcaccctgggtg
H2Q9G4_BCL2L10-01       -----------------------g-ttaacaacagccttc---------a
G2HFR3_MCL1-01          -----------------------gagtaggagctggtttg---------g
A0A2I3RTV4_MCL1-03      -----------------------gagtaggagctggtttg---------g
A0A2I3RTV4_MCL1-01      -----------------------gagtaggagctggtttg---------g
                                                  *   * *                 

H2Q805_BCL2L2-01        ----------------------------------------------tga
H2Q805_BCL2L2-02        cgtctacaggggccgggctagagcgacatcatggtattccccttactaa
H2QEM8_BCL2-01          cctatct-gggccacaagtga----------------------------
H2Q9G4_BCL2L10-01       tttatctctggacacgattatta-----------------------tga
G2HFR3_MCL1-01          catatct---------aataaga-----------------------tag
A0A2I3RTV4_MCL1-03      catatct---------aataaga-----------------------tag
A0A2I3RTV4_MCL1-01      catatct---------aataaga-----------------------tag
                                                                         

© 1998-2019