Dataset for CDS BCL-2-like of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3T6T8_BCL2A1-      -gtggc-----------------------------------------gcg
A0A2I3T6T8_BCL2A1-      -atgacagac------------------------------------tgtg
A0A2I3T6T8_BCL2A1-      -atgacagac------------------------------------tgtg
A0A2I3T6T8_BCL2A1-      -atgacagac------------------------------------tgtg
H2Q805_BCL2L2-02        -atggcgaccccagcctcagccccagaca-----cacgggctctggtggc
H2Q805_BCL2L2-01        -atggcgaccccagcctcagccccagaca-----cacgggctctggtggc
H2QEM8_BCL2-01          -atggcgcacgctgggagaacagggtacgataaccggga--gatagtgat
H2Q9G4_BCL2L10-01       -atggttg------------------------------accagtggcgtg
G2HFR3_MCL1-01          -atg-------------gacat----------------------------
K7DE58_MCL1-04          agtgtt-----------gaaacgtg-------------------------
K7DE58_MCL1-02          -atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
K7DE58_MCL1-03          -atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
K7DE58_MCL1-01          -atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg

A0A2I3T6T8_BCL2A1-      atcttggct-----------------------------------------
A0A2I3T6T8_BCL2A1-      aatttggatatatttacaggctggctcagga-------------------
A0A2I3T6T8_BCL2A1-      aatttggatatatttacaggctggctcagga-------------------
A0A2I3T6T8_BCL2A1-      aatttggatatatttacaggctggctcagga-------------------
H2Q805_BCL2L2-02        agactttgtaggtta-taagctgaggcagaagggttat------------
H2Q805_BCL2L2-01        agactttgtaggtta-taagctgaggcagaagggttat------------
H2QEM8_BCL2-01          gaagtacatccatta-taagctgtcgcagaggggctacgagtgggatgcg
H2Q9G4_BCL2L10-01       agcgcaccaccatggccgacccgctgcgggagcgcacc----------ga
G2HFR3_MCL1-01          -----------ttgc-cggctctcagcagcaatgc---------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          ggggggccggcttgg-gggccggcagcggcggcgccacccctccgggagg
K7DE58_MCL1-03          ggggggccggcttgg-gggccggcagcggcggcgccacccctccgggagg
K7DE58_MCL1-01          ggggggccggcttgg-gggccggcagcggcggcgccacccctccgggagg

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      ----------------ctatctgcagtacgtcctac--------------
A0A2I3T6T8_BCL2A1-      ----------------ctatctgcagtacgtcctac--------------
A0A2I3T6T8_BCL2A1-      ----------------ctatctgcagtacgtcctac--------------
H2Q805_BCL2L2-02        ------------------gtctgtggagctggccccgggg----------
H2Q805_BCL2L2-01        ------------------gtctgtggagctggccccgggg----------
H2QEM8_BCL2-01          ggagatgtgggcgccgcgcccccgggggccgcccccg-------------
H2Q9G4_BCL2L10-01       gcggttgctggc-cgactacctggggtactgcgcccg-------------
G2HFR3_MCL1-01          gtgaatttta----------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          gcgacttttggc-tacggagaaggaggcctcggcccggcgagagataggg
K7DE58_MCL1-03          gcgactttt-----------------------------------------
K7DE58_MCL1-01          gcgacttttggc-tacggagaaggaggcctcggcccggcgagagataggg

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          ggaggggaggccggcgcggtgattggcggaagcgctggcgcaagcccccc
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          ggaggggaggccggcgcggtgattggcggaagcgctggcgcaagcccccc

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          gtccaccctcacgccagactcccggagggtcgcgcggccgccgcccattg
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          gtccaccctcacgccagactcccggagggtcgcgcggccgccgcccattg

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          ---------------------------------------caccgggcatc
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          gcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttc
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          gcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttc

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          ttctcctcccagcccgggcacacgccccatccagccgcatcccgggaccc
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          gcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgc
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          gcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgc

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          ggtcgccaggacctcgccgctgcagaccccggc-----------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagc
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagc

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          ctctcgggaagcggccggctgtcctgcctctgctggagttggtcggggaa
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          ctctcgggaagcggccggctgtcctgcctctgctggagttggtcggggaa

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          tctggtaataacaccagtacggacgggtcactaccctcgacgccgccgcc
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          tctggtaataacaccagtacggacgggtcactaccctcgacgccgccgcc

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct

A0A2I3T6T8_BCL2A1-      ----------------------cactgcag--------cctcg-------
A0A2I3T6T8_BCL2A1-      -------------------agataccacaa--------cctggatcaggt
A0A2I3T6T8_BCL2A1-      -------------------agataccacaa--------cctggatcaggt
A0A2I3T6T8_BCL2A1-      -------------------agataccacaa--------cctggatcaggt
H2Q805_BCL2L2-02        -------------------agggcccagcagctgacccgctgcaccaagc
H2Q805_BCL2L2-01        -------------------agggcccagcagctgacccgctgcaccaagc
H2QEM8_BCL2-01          -------------------tgcccccggcg------ccgccg---cgggg
H2Q9G4_BCL2L10-01       -------------------ggaacccggca------cccccgagccgacg
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          ctcggtaccttcgggagcaggccaccggcg------ccaaggacacaaag
K7DE58_MCL1-03          -------------------ggccaccggcg------ccaaggacacaaag
K7DE58_MCL1-01          ctcggtaccttcgggagcaggccaccggcg------ccaaggacacaaag

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      ccaagcaaaacgtccagagtgctacaaaatgttgcattctcagtccaaaa
A0A2I3T6T8_BCL2A1-      ccaagcaaaacgtccagagtgctacaaaatgttgcattctcagtccaaaa
A0A2I3T6T8_BCL2A1-      ccaagcaaaacgtccagagtgctacaaaatgttgcattctcagtccaaaa
H2Q805_BCL2L2-02        catgcgggca----------------------------------------
H2Q805_BCL2L2-01        catgcgggca----------------------------------------
H2QEM8_BCL2-01          cctgcgctca-gcccggtgccacct-----gtggtccacctgaccctccg
H2Q9G4_BCL2L10-01       cc---gtccacgcccgaggccgccg---------------------tgct
G2HFR3_MCL1-01          -cattgtgca-------------------------tctggatatataccc
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          ccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacg
K7DE58_MCL1-03          ccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacg
K7DE58_MCL1-01          ccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacg

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      agaagtggaaaagaatctgaagtcatgcttgga------caatgttaatg
A0A2I3T6T8_BCL2A1-      agaagtggaaaagaatctgaagtcatgcttgga------caatgttaatg
A0A2I3T6T8_BCL2A1-      agaagtggaaaagaatctgaagtcatgcttgga------caatgttaatg
H2Q805_BCL2L2-02        ----gctggagatgagttcgagacccgcttccggcg---caccttctctg
H2Q805_BCL2L2-01        ----gctggagatgagttcgagacccgcttccggcg---caccttctctg
H2QEM8_BCL2-01          ccaggccggcgacgacttctcccgccgctaccgccg---cgacttcgccg
H2Q9G4_BCL2L10-01       gcgctccgcggccgccaggttacggcagatccaccggtccttcttctccg
G2HFR3_MCL1-01          accacctgagtgtacca---ttca--------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          acgggttggggatggcg---tgcagcgcaaccatgagacggccttccaa-
K7DE58_MCL1-03          acgggttggggatggcg---tgcagcgcaaccatgagacggccttccaag
K7DE58_MCL1-01          acgggttggggatggcg---tgcagcgcaaccatgagacggccttccaag

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      ttgtgtctg------------------tagacactgccagaacactattc
A0A2I3T6T8_BCL2A1-      ttgtgtctg------------------tagacactgccagaacactattc
A0A2I3T6T8_BCL2A1-      ttgtgtctg------------------tagacactgccagaacactattc
H2Q805_BCL2L2-02        atctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttc
H2Q805_BCL2L2-01        atctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttc
H2QEM8_BCL2-01          agatgtccagccagctgcacctgacgcccttcaccgcgcggggacgcttt
H2Q9G4_BCL2L10-01       -cctacctcggctacc-----------ccgggaaccgcttcgagctggtg
G2HFR3_MCL1-01          -catgtt------actggacatcaaaaacgaagacgatgtgaaatcgttg
K7DE58_MCL1-04          -catgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttg
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          gcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttg
K7DE58_MCL1-01          gcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttg

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      aaccaagtgatggaaaaggagtttgaagatgg---catcattaactgggg
A0A2I3T6T8_BCL2A1-      aaccaagtgatggaaaaggagtttgaagatgg---catcattaactgggg
A0A2I3T6T8_BCL2A1-      aaccaagtgatggaaaaggagtttgaagatgg---catcattaactgggg
H2Q805_BCL2L2-02        acccaggtctccgatgaactttttcaaggggg------ccccaactgggg
H2Q805_BCL2L2-01        acccaggtctccgatgaactttttcaaggggg------ccccaactgggg
H2QEM8_BCL2-01          gccacggtggtggaggagctcttcagggacgg------ggtgaactgggg
H2Q9G4_BCL2L10-01       gcgctgatggcggattccgtgctctccgacagccccggccccacctgggg
G2HFR3_MCL1-01          tctcgagtgatgatccatgttttcagcgacgg---cgtaacaaactgggg
K7DE58_MCL1-04          tctcgagtgatgatccatgttttcagcgacgg---cgtaacaaactgggg
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          tctcgagtgatgatccatgttttcagcgacgg---cgtaacaaactgggg
K7DE58_MCL1-01          tctcgagtgatgatccatgttttcagcgacgg---cgtaacaaactgggg

A0A2I3T6T8_BCL2A1-      -------------------------------------------------a
A0A2I3T6T8_BCL2A1-      aagaattgtaaccatatttgcatttgaaggtattctcatcaa----gaaa
A0A2I3T6T8_BCL2A1-      aagaattgtaaccatatttgcatttgaaggtattctcatcaa----gaaa
A0A2I3T6T8_BCL2A1-      aagaattgtaaccatatttgcatttgaaggtattctcatcaa----gaaa
H2Q805_BCL2L2-02        ccgccttgtagccttctttgtctttgggg-----------------ctgc
H2Q805_BCL2L2-01        ccgccttgtagccttctttgtctttgggg-----------------ctgc
H2QEM8_BCL2-01          gaggattgtggccttctttgagttcggtg-----------------gggt
H2Q9G4_BCL2L10-01       cagagtggtgacgctcgtgaccttcgcagggacgctgctggagagagggc
G2HFR3_MCL1-01          caggattgtgactctcatttctttt---------------------ggtg
K7DE58_MCL1-04          caggattgtgactctcatttctttt---------------------ggtg
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          caggattgtgactctcatttctttt---------------------ggtg
K7DE58_MCL1-01          caggattgtgactctcatttctttt---------------------ggtg

A0A2I3T6T8_BCL2A1-      cctccac-------------------------------------------
A0A2I3T6T8_BCL2A1-      cttctacg------------------------------------------
A0A2I3T6T8_BCL2A1-      cttctacg------------------------------------------
A0A2I3T6T8_BCL2A1-      cttctacg------------------------------------------
H2Q805_BCL2L2-02        actgtgtg----------ctgaga---------------------gtgtc
H2Q805_BCL2L2-01        actgtgtg----------ctgaga---------------------gtgtc
H2QEM8_BCL2-01          catgtgtg----------tggaga---------------------gcgtc
H2Q9G4_BCL2L10-01       cgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaat
G2HFR3_MCL1-01          cctttgtggctaaacacttgaaga---------------------ccata
K7DE58_MCL1-04          cctttgtggctaaacacttgaaga---------------------ccata
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          cctttgtggctaaacacttgaaga---------------------ccata
K7DE58_MCL1-01          cctttgtggctaaacacttgaaga---------------------ccata

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --acagcaaattgccccggatgtggatacttataaggagatttcatattt
A0A2I3T6T8_BCL2A1-      --acagcaaattgccccggatgtggatacttataaggagatttcatattt
A0A2I3T6T8_BCL2A1-      --acagcaaattgccccggatgtggatacttataaggagatttcatattt
H2Q805_BCL2L2-02        aacaaggaga-tggaaccactggtgg--gacaagtgcagga------gtg
H2Q805_BCL2L2-01        aacaaggaga-tggaaccactggtgg--gacaagtgcagga------gtg
H2QEM8_BCL2-01          aaccgggaga----tgtcgcccctggtggacaacatc-----gccctgtg
H2Q9G4_BCL2L10-01       gagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgct
G2HFR3_MCL1-01          aaccaagaaagctgcatcga--------accattagcagaaagtatcaca
K7DE58_MCL1-04          aaccaagaaagctgcatcga--------accattagcagaaagtatcaca
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          aaccaagaaagctgcatcga--------accattagcagaaagtatcaca
K7DE58_MCL1-01          aaccaagaaagctgcatcga--------accattagcagaaagtatcaca

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      tgttgcggagttcataatgaataacacaggagaatggataagacaaaacg
A0A2I3T6T8_BCL2A1-      tgttgcggagttcataatgaataacacaggagaatggataagacaaaacg
A0A2I3T6T8_BCL2A1-      tgttgcggagttcataatgaataacacaggagaatggataagacaaaacg
H2Q805_BCL2L2-02        gatggtggcctacctggagacgcggctggctgactggatccacagcagtg
H2Q805_BCL2L2-01        gatggtggcctacctggagacgcggctggctgactggatccacagcagtg
H2QEM8_BCL2-01          gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
H2Q9G4_BCL2L10-01       gagctcgcggctcgtggggcagcac---cgcgcctggctgcaggctcagg
G2HFR3_MCL1-01          gacgtt----ctcgtaaggacaaaa---cgggactggctagttaaacaaa
K7DE58_MCL1-04          gacgtt----ctcgtaaggacaaaa---cgggactggctagttaaacaaa
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          gacgtt----ctcgtaaggacaaaa---cgggactggctagttaaacaaa
K7DE58_MCL1-01          gacgtt----ctcgtaaggacaaaa---cgggactggctagttaaacaaa

A0A2I3T6T8_BCL2A1-      --ggctcaaga--aaatggctttgtaaagaagttt--------gaacata
A0A2I3T6T8_BCL2A1-      gaggctggggg--aaatggc---------acaatc--------acacgcc
A0A2I3T6T8_BCL2A1-      gaggct-ggga--aaatggctttgtaaagaagttt--------gaacata
A0A2I3T6T8_BCL2A1-      gaggct-ggga--aaatggctttgtaaagaagttt--------gaacata
H2Q805_BCL2L2-02        ggggctgggagctggaagctatcaaagctcgagtcagggagatgga----
H2Q805_BCL2L2-01        ggggctgggcg------gagttcacagctctatacggggacggggcc---
H2QEM8_BCL2-01          gaggctgggat------gcctttgtggaactgtac--------ggcc---
H2Q9G4_BCL2L10-01       gcggctgggat------ggcttttgtcacttcttc-------aggac---
G2HFR3_MCL1-01          gaggctgggat------gggtttgtggagttcttccatgtagaggac---
K7DE58_MCL1-04          gaggctgggat------gggtttgtggagttcttccatgtagaggac---
K7DE58_MCL1-02          -------ggat------gggtttgtggagttcttccatgtagaggac---
K7DE58_MCL1-03          gaggctgggat------gggtttgtggagttcttccatgtagaggac---
K7DE58_MCL1-01          gaggctgggat------gggtttgtggagttcttccatgtagaggac---

A0A2I3T6T8_BCL2A1-      aat-ctggctg---------------------------------------
A0A2I3T6T8_BCL2A1-      tatgctggtag---------------------------------------
A0A2I3T6T8_BCL2A1-      aat-ctggctg---------------------------------------
A0A2I3T6T8_BCL2A1-      aat-ctggctg---------------------------------------
H2Q805_BCL2L2-02        ------ggaagaagctgagaagctaaaggagctacagaacgaggtagaga
H2Q805_BCL2L2-01        ----ctggaggaggcgcggcgtctgcgggag---------------ggga
H2QEM8_BCL2-01          ----ccagcat----gcggcctctgtttgatttct---------------
H2Q9G4_BCL2L10-01       ----cc----------------------cctttcc---------------
G2HFR3_MCL1-01          ----ctagaag----gtggcatcag-gaatgtgct---------------
K7DE58_MCL1-04          ----ctagaag----gtggcatcag-gaatgtgct---------------
K7DE58_MCL1-02          ----ctagaag----gtggcatcag-gaatgtgct---------------
K7DE58_MCL1-03          ----ctagaag----gtggcatcag-gaatgtgct---------------
K7DE58_MCL1-01          ----ctagaag----gtggcatcag-gaatgtgct---------------

A0A2I3T6T8_BCL2A1-      gatgacttttctagaa----------gttacaggaaag------------
A0A2I3T6T8_BCL2A1-      agtcagtggcccacaa----------gaagaggaaaat------------
A0A2I3T6T8_BCL2A1-      gatgacttttctagaa----------gttacaggaaag------------
A0A2I3T6T8_BCL2A1-      gatgacttttctagaa----------gttacaggaaag------------
H2Q805_BCL2L2-02        agcagatgaatatgagtccaccaccaggcaatgctggcccagtgatcatg
H2Q805_BCL2L2-01        actgggcatcagtgag----------gacagtgctgac------------
H2QEM8_BCL2-01          cctggctgtctctgaa----------gactctgctcag------------
H2Q9G4_BCL2L10-01       gctggct-ttttggag----------aaaacagctggt------------
G2HFR3_MCL1-01          gctggct-ttt--gca----------ggtgttgctgga------------
K7DE58_MCL1-04          gctggct-ttt--gca----------ggtgttgctgga------------
K7DE58_MCL1-02          gctggct-ttt--gca----------ggtgttgctgga------------
K7DE58_MCL1-03          gctggct-ttt--gca----------ggtgttgctgga------------
K7DE58_MCL1-01          gctggct-ttt--gca----------ggtgttgctgga------------

A0A2I3T6T8_BCL2A1-      -------------------------------------------------a
A0A2I3T6T8_BCL2A1-      -------------------------------------------------g
A0A2I3T6T8_BCL2A1-      -------------------------------------------------a
A0A2I3T6T8_BCL2A1-      -------------------------------------------------a
H2Q805_BCL2L2-02        tccattgaggagaagatggaggctgatgcccgttccatctatgttggcaa
H2Q805_BCL2L2-01        -----------------gggggccg-------------------tggcac
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------

A0A2I3T6T8_BCL2A1-      tctcaatactgtt-------------------------------------
A0A2I3T6T8_BCL2A1-      gc------------------------------------------------
A0A2I3T6T8_BCL2A1-      tctcaatactgtt-------------------------------------
A0A2I3T6T8_BCL2A1-      tc------------------------------------------------
H2Q805_BCL2L2-02        tgtggactatggtgcaacagcagaagagctggaagctcactttcatggct
H2Q805_BCL2L2-01        tgggggccctggt-------------------------------------
H2QEM8_BCL2-01          -tttggccctggt-------------------------------------
H2Q9G4_BCL2L10-01       -ccag--gctttt-------------------------------------
G2HFR3_MCL1-01          -gtaggagctggt-------------------------------------
K7DE58_MCL1-04          -gtaggagctggt-------------------------------------
K7DE58_MCL1-02          -gtaggagctggt-------------------------------------
K7DE58_MCL1-03          -gtaggagctggt-------------------------------------
K7DE58_MCL1-01          -gtaggagctggt-------------------------------------

A0A2I3T6T8_BCL2A1-      -----------------------------------gaccagaaaggacac
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      -----------------------------------gaccagaaaggacac
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        gtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccat
H2Q805_BCL2L2-01        -----------------------------------aactgtaggggcctt
H2QEM8_BCL2-01          -------------------------------------------ggga---
H2Q9G4_BCL2L10-01       -------------------------------------------ctgtcat
G2HFR3_MCL1-01          -------------------------------------------ttggcat
K7DE58_MCL1-04          -------------------------------------------ttggcat
K7DE58_MCL1-02          -------------------------------------------ttggcat
K7DE58_MCL1-03          -------------------------------------------ttggcat
K7DE58_MCL1-01          -------------------------------------------ttggcat

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        cccaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggac
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        ttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtga
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        tcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttt
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-02        ccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctc
H2Q805_BCL2L2-01        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
K7DE58_MCL1-04          --------------------------------------------------
K7DE58_MCL1-02          --------------------------------------------------
K7DE58_MCL1-03          --------------------------------------------------
K7DE58_MCL1-01          --------------------------------------------------

A0A2I3T6T8_BCL2A1-      ---------------tccatattgtgaaaccggcctaatttttctgactg
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      ---------------tccatattgtgaaaccggcctaatttttctgactg
A0A2I3T6T8_BCL2A1-      ----------------------tgtgaaat---gctatctctcct-----
H2Q805_BCL2L2-02        tcgattctacagtggttttaacagcaggccccggggtcgcgtctacaggg
H2Q805_BCL2L2-01        ---------------ttttgctagcaag----------------------
H2QEM8_BCL2-01          -------------------gcttgcatcaccctgggtgcctatctgggcc
H2Q9G4_BCL2L10-01       ---------------gcttgttaacaacagccttcatttatctctgg---
G2HFR3_MCL1-01          ---------------atctaataa----------------------g---
K7DE58_MCL1-04          ---------------atctaataa----------------------g---
K7DE58_MCL1-02          ---------------atctaataa----------------------g---
K7DE58_MCL1-03          ---------------atctaataa----------------------g---
K7DE58_MCL1-01          ---------------atctaataa----------------------g---

A0A2I3T6T8_BCL2A1-      ttatggaaacgattgccaacacatacttctacttttaa
A0A2I3T6T8_BCL2A1-      -------------------------------tttgtaa
A0A2I3T6T8_BCL2A1-      ttatggaaacgattgccaacacatacttctacttttaa
A0A2I3T6T8_BCL2A1-      -----gaagcaa-----------------tactgttga
H2Q805_BCL2L2-02        gccgggctagagcgacatcatggtattccccttactaa
H2Q805_BCL2L2-01        -----------------------------------tga
H2QEM8_BCL2-01          acaa-------g-----------------------tga
H2Q9G4_BCL2L10-01       acacgattatta-----------------------tga
G2HFR3_MCL1-01          atag----------------------------------
K7DE58_MCL1-04          atag----------------------------------
K7DE58_MCL1-02          atagccttactg-----------------------taa
K7DE58_MCL1-03          atag----------------------------------
K7DE58_MCL1-01          atag----------------------------------

© 1998-2019