Dataset for CDS BCL2L2 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2Q805_BCL2L2-01      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
H2Q805_BCL2L2-02      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
                      **************************************************

H2Q805_BCL2L2-01      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
H2Q805_BCL2L2-02      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
                      **************************************************

H2Q805_BCL2L2-01      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
H2Q805_BCL2L2-02      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                      **************************************************

H2Q805_BCL2L2-01      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
H2Q805_BCL2L2-02      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
                      **************************************************

H2Q805_BCL2L2-01      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
H2Q805_BCL2L2-02      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
                      **************************************************

H2Q805_BCL2L2-01      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
H2Q805_BCL2L2-02      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
                      **************************************************

H2Q805_BCL2L2-01      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
H2Q805_BCL2L2-02      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
                      **************************************************

H2Q805_BCL2L2-01      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
H2Q805_BCL2L2-02      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                      **************************************************

H2Q805_BCL2L2-01      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
H2Q805_BCL2L2-02      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
                      ********************************* *      *   *** *

H2Q805_BCL2L2-01      gctctatacggggacggggccctggaggaggcgcggcgtctgcgggag--
H2Q805_BCL2L2-02      gctcgagtcagggagatgga---ggaagaagctgagaagctaaaggagct
                      **** *  * ****   **    *** ** **   *   **   ****  

H2Q805_BCL2L2-01      -------------gggaactgggcatcagtgag----------gacagtg
H2Q805_BCL2L2-02      acagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatg
                                   * ***   *       ****          * ** **

H2Q805_BCL2L2-01      ctgac-----------------------------gggggccg--------
H2Q805_BCL2L2-02      ctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgt
                      *** *                             ** *** *        

H2Q805_BCL2L2-01      -----------tggcactgggggccctggt--------------------
H2Q805_BCL2L2-02      tccatctatgttggcaatgtggactatggtgcaacagcagaagagctgga
                                 ***** ** ** *  ****                    

H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      agctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtg
                                                                        

H2Q805_BCL2L2-01      --aactgtaggggcctt---------------------------------
H2Q805_BCL2L2-02      acaaatttagtggccatcccaaagggtttgcgtatatagagttctcagac
                        ** * *** **** *                                 

H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      aaagagtcagtgaggacttccttggccttagatgagtccctatttagagg
                                                                        

H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      aaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagca
                                                                        

H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      caacagaccggggttttccacgagcccgctaccgcgcccggaccaccaac
                                                                        

H2Q805_BCL2L2-01      --------------------------------ttttgctagcaag-----
H2Q805_BCL2L2-02      tacaacagttcccgctctcgattctacagtggttttaacagcaggccccg
                                                      ****   **** *     

H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      gggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt
                                                                        

H2Q805_BCL2L2-01      --tga
H2Q805_BCL2L2-02      actaa
                        * *

© 1998-2018