Dataset for CDS BCL2A1 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3T6T8_BCL2A1-      gtggc-----gcgatcttggct----------------------------
A0A2I3T6T8_BCL2A1-      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
A0A2I3T6T8_BCL2A1-      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
A0A2I3T6T8_BCL2A1-      atgacagactgtgaatttggatatatttacaggctggctcaggactatct
                         ** *     * **  **** *                            

A0A2I3T6T8_BCL2A1-      -----------------cactgcagcctcg--------------------
A0A2I3T6T8_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagcaaaacgt
A0A2I3T6T8_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagcaaaacgt
A0A2I3T6T8_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagcaaaacgt
                                          **  ** *** *                    

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      ccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaag
A0A2I3T6T8_BCL2A1-      ccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaag
A0A2I3T6T8_BCL2A1-      ccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaag

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgc
A0A2I3T6T8_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgc
A0A2I3T6T8_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgc

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
A0A2I3T6T8_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
A0A2I3T6T8_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2I3T6T8_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2I3T6T8_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc

A0A2I3T6T8_BCL2A1-      -----acctccac-------------------------------------
A0A2I3T6T8_BCL2A1-      aagaaacttctacgacagcaaattgccccggatgtggatacttataagga
A0A2I3T6T8_BCL2A1-      aagaaacttctacgacagcaaattgccccggatgtggatacttataagga
A0A2I3T6T8_BCL2A1-      aagaaacttctacgacagcaaattgccccggatgtggatacttataagga
                             ** ** **                                     

A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
A0A2I3T6T8_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
A0A2I3T6T8_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga

A0A2I3T6T8_BCL2A1-      --------------ggctcaagaaaatggctttgtaaagaagtttgaaca
A0A2I3T6T8_BCL2A1-      taagacaaaacggaggctgggggaaatggc---------acaatcacacg
A0A2I3T6T8_BCL2A1-      taagacaaaacggaggct-gggaaaatggctttgtaaagaagtttgaaca
A0A2I3T6T8_BCL2A1-      taagacaaaacggaggct-gggaaaatggctttgtaaagaagtttgaaca
                                      ****   * *******         *   *   ** 

A0A2I3T6T8_BCL2A1-      taaat-ctggctggatgacttttctagaagttacaggaaagatctcaata
A0A2I3T6T8_BCL2A1-      cctatgctggtagagtcagtggcccacaagaagaggaaaatggc------
A0A2I3T6T8_BCL2A1-      taaat-ctggctggatgacttttctagaagttacaggaaagatc------
A0A2I3T6T8_BCL2A1-      taaat-ctggctggatgacttttctagaagttacaggaaagatctcaata
                           ** ****  *  * * *   * * ***     * ***   *      

A0A2I3T6T8_BCL2A1-      ctgttgaccagaaaggacactccatattgtgaaaccggcctaatttttct
A0A2I3T6T8_BCL2A1-      --------------------------------------------------
A0A2I3T6T8_BCL2A1-      ---------------------------tgtgaaat---gctatctctcct
A0A2I3T6T8_BCL2A1-      ctgttgaccagaaaggacactccatattgtgaaaccggcctaatttttct

A0A2I3T6T8_BCL2A1-      gactgttatggaaacgattgccaacacatacttctacttttaa
A0A2I3T6T8_BCL2A1-      ------------------------------------tttgtaa
A0A2I3T6T8_BCL2A1-      ----------gaagcaa-----------------tactgttga
A0A2I3T6T8_BCL2A1-      gactgttatggaaacgattgccaacacatacttctacttttaa
                                                             *  * *

© 1998-2019