Dataset for CDS BCL-2-like of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R8ZJX9_BCL2A1-      atgacagact------gtgaatttggatatatttacag--gctggctcag
A0A2R8ZJX9_BCL2A1-      atgacagact------gtgaatttggatatatttacag--gctggctcag
A0A2R8ZJX9_BCL2A1-      atgacagact------gtgaatttggatatatttacag--gctggctcag
A0A2R9A7B2_BCL2L2-      atggcgaccc--cagcctcagc---cccagacacacgggctctggtggca
A0A2R9A7B2_BCL2L2-      atggcgaccc--cagcctcagc---cccagacacacgggctctggtggca
A0A2R9BCD9_BCL2L10      atggttgaccagtggcgtgagcgcactaccatggccga------------
A0A2R9APW6_BCL2-01      atggcgcacg--ctgggagaacagggtacgataaccgggagatagtgatg
A0A2R9BYH6_MCL1-02      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R9BYH6_MCL1-03      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R9BYH6_MCL1-01      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
                        ***     *          *               *              

A0A2R8ZJX9_BCL2A1-      gactatctgcagtacgtcctacagataccacaacctggatcaggtccaag
A0A2R8ZJX9_BCL2A1-      gactatctgcagtacgtcctacagataccacaacctggatcaggtccaag
A0A2R8ZJX9_BCL2A1-      gactatctgcagtacgtcctacagataccacaacctggatcaggtccaag
A0A2R9A7B2_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgtggagctgg
A0A2R9A7B2_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgtggagctgg
A0A2R9BCD9_BCL2L10      -----------------cccgctgcgggagcgcaccgagc-ggttgctgg
A0A2R9APW6_BCL2-01      aagtacatccattataagctgtcgcagaggggctacgagtgggatgcggg
A0A2R9BYH6_MCL1-02      ------actcaacct---ctactgtgggggggc--cggcttgggggccgg
A0A2R9BYH6_MCL1-03      ------actcaacct---ctactgtgggggggc--cggcttgggggccgg
A0A2R9BYH6_MCL1-01      ------actcaacct---ctactgtgggggggc--cggcttgggggccgg
                                          *    *            *     *   *  *

A0A2R8ZJX9_BCL2A1-      ccaaacgtccagagtgctac-------aaaatgttgc-------------
A0A2R8ZJX9_BCL2A1-      ccaaacgtccagagtgctac-------aaaatgttgc-------------
A0A2R8ZJX9_BCL2A1-      ccaaacgtccagagtgctac-------aaaatgttgc-------------
A0A2R9A7B2_BCL2L2-      ccc-----cggggagggcccagcagctgacccgctgc-------------
A0A2R9A7B2_BCL2L2-      ccc-----cggggagggcccagcagctgacccgctgc-------------
A0A2R9BCD9_BCL2L10      ccgactacctggggtactgcgcccgggaacccggcac-------------
A0A2R9APW6_BCL2-01      aga-----tgtgggcgccgcgcccctcagcccggtgccacctgtgg----
A0A2R9BYH6_MCL1-02      cag-----cggcggcgccacccctccggg---agggcgacttttggctac
A0A2R9BYH6_MCL1-03      cag-----cggcggcgccacccctccggg---agggcgactttt------
A0A2R9BYH6_MCL1-01      cag-----cggcggcgccacccctccggg---agggcgacttttggctac
                                           *                *             

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      ggagaaggaggcctcggcccggcgagagatagggggaggggaggccggcg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      ggagaaggaggcctcggcccggcgagagatagggggaggggaggccggcg

A0A2R8ZJX9_BCL2A1-      --------------------------------attctcagtccaaaaaga
A0A2R8ZJX9_BCL2A1-      --------------------------------attctcagtccaaaaaga
A0A2R8ZJX9_BCL2A1-      --------------------------------attctcagtccaaaaaga
A0A2R9A7B2_BCL2L2-      ----------------------------------accaagccatgcgggc
A0A2R9A7B2_BCL2L2-      ----------------------------------accaagccatgcgggc
A0A2R9BCD9_BCL2L10      ---------------------------------------------ccccg
A0A2R9APW6_BCL2-01      -------------------------------tccacctgaccctccgcca
A0A2R9BYH6_MCL1-02      cggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgcca
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      cggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgcca

A0A2R8ZJX9_BCL2A1-      agtggaaaagaatctgaagtcatgct-----------------tggacaa
A0A2R8ZJX9_BCL2A1-      agtggaaaagaatctgaagtcatgct-----------------tggacaa
A0A2R8ZJX9_BCL2A1-      agtggaaaagaatctgaagtcatgct-----------------tggacaa
A0A2R9A7B2_BCL2L2-      agctggagatgagttcgagacccgcttcc--------------ggcgcac
A0A2R9A7B2_BCL2L2-      agctggagatgagttcgagacccgcttcc--------------ggcgcac
A0A2R9BCD9_BCL2L10      agccgacgccgtccacgcccgaggccgcc-----gtgctgcgctccgcgg
A0A2R9APW6_BCL2-01      ggccggcgacgacttctcccgccgctacc--------------gccgcga
A0A2R9BYH6_MCL1-02      gactcccggagggtcgcgcggccgccgcccattggcgccgaggtccccga
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      gactcccggagggtcgcgcggccgccgcccattggcgccgaggtccccga

A0A2R8ZJX9_BCL2A1-      tgttaatgttgtgtctgta------------------------------g
A0A2R8ZJX9_BCL2A1-      tgttaatgttgtgtctgta------------------------------g
A0A2R8ZJX9_BCL2A1-      tgttaatgttgtgtctgta------------------------------g
A0A2R9A7B2_BCL2L2-      cttctctgatctggcg---gctcagctgcatgtgacccca---------g
A0A2R9A7B2_BCL2L2-      cttctctgatctggcg---gctcagctgcatgtgacccca---------g
A0A2R9BCD9_BCL2L10      c--cgccaggttacggcagatccaccggtccttcttctccgcctacctcg
A0A2R9APW6_BCL2-01      cttcgccgagatgtcc---agccagctgcacctgacgccc-ttcaccgcg
A0A2R9BYH6_MCL1-02      cgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      cgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcg

A0A2R8ZJX9_BCL2A1-      acactgccagaacactatt--------------------------caacc
A0A2R8ZJX9_BCL2A1-      acactgccagaacactatt--------------------------caacc
A0A2R8ZJX9_BCL2A1-      acactgccagaacactatt--------------------------caacc
A0A2R9A7B2_BCL2L2-      gctcagcccaacaacgctt--------------------------caccc
A0A2R9A7B2_BCL2L2-      gctcagcccaacaacgctt--------------------------caccc
A0A2R9BCD9_BCL2L10      gctaccccgggaaccgctt--------------------------cgagc
A0A2R9APW6_BCL2-01      --------cggggacgctt--------------------------tgcca
A0A2R9BYH6_MCL1-02      --------cggcgccgcttgaggagatggaagccccggccgccgacgcca
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------cggcgccgcttgaggagatggaagccccggccgccgacgcca

A0A2R8ZJX9_BCL2A1-      aagtgatg---gaaaaggagtt----------------------------
A0A2R8ZJX9_BCL2A1-      aagtgatg---gaaaaggagtt----------------------------
A0A2R8ZJX9_BCL2A1-      aagtgatg---gaaaaggagtt----------------------------
A0A2R9A7B2_BCL2L2-      aggtctcc------gatgaact----------------------------
A0A2R9A7B2_BCL2L2-      aggtctcc------gatgaact----------------------------
A0A2R9BCD9_BCL2L10      tggtggcgctgatggcggattc----------------------------
A0A2R9APW6_BCL2-01      cggtggtg------gaggagct----------------------------
A0A2R9BYH6_MCL1-02      tcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcggg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      tcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcggg

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      aagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaa
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      aagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaa

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      -----------cgtgctctccgacagccccggccccacctggggcagagt
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      taacaccagtacggacgggtcactaccctcgacgccgccgccagcagagg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      taacaccagtacggacgggtcactaccctcgacgccgccgccagcagagg

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      gg-----------------------------------tgacgctcgtgac
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      aggaggaggacgagttgtaccggcagtcgctggagattatctctcggtac
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      aggaggaggacgagttgtaccggcagtcgctggagattatctctcggtac

A0A2R8ZJX9_BCL2A1-      --------------------tgaagatggcatca-ttaactggggaagaa
A0A2R8ZJX9_BCL2A1-      --------------------tgaagatggcatca-ttaactggggaagaa
A0A2R8ZJX9_BCL2A1-      --------------------tgaagatggcatca-ttaactggggaagaa
A0A2R9A7B2_BCL2L2-      -------------------ttttcaagggggcc--ccaactggggccgcc
A0A2R9A7B2_BCL2L2-      -------------------ttttcaagggggcc--ccaactggggccgcc
A0A2R9BCD9_BCL2L10      cttcg------------------cagggacgctgctggagagagggccgc
A0A2R9APW6_BCL2-01      --------------------cttcagggacgggg-tgaactgggggagga
A0A2R9BYH6_MCL1-02      cttcgggagcaggccaccggcgccaaggacacaa-agccaatgggcaggt
A0A2R9BYH6_MCL1-03      -----------ggccaccggcgccaaggacacaa-agccaatgggcaggt
A0A2R9BYH6_MCL1-01      cttcgggagcaggccaccggcgccaaggacacaa-agccaatgggcaggt
                                                   *               **     

A0A2R8ZJX9_BCL2A1-      ttgtaaccatattt-----gcatttgaaggtattctcatcaagaaacttc
A0A2R8ZJX9_BCL2A1-      ttgtaaccatattt-----gcatttgaaggtattctcatcaagaaacttc
A0A2R8ZJX9_BCL2A1-      ttgtaaccatattt-----gcatttgaaggtattctcatcaagaaacttc
A0A2R9A7B2_BCL2L2-      ttgtagccttcttt-----gtctttgggg--------------------c
A0A2R9A7B2_BCL2L2-      ttgtagccttcttt-----gtctttgggg--------------------c
A0A2R9BCD9_BCL2L10      tggtgaccacccggtggaagaagtggggc--------------------t
A0A2R9APW6_BCL2-01      ttgtggccttc--tttgagttcggtgggg--------------------t
A0A2R9BYH6_MCL1-02      ctggggccaccagcaggaaggcgctggag--------------------a
A0A2R9BYH6_MCL1-03      ctggggccaccagcaggaaggcgctggag--------------------a
A0A2R9BYH6_MCL1-01      ctggggccaccagcaggaaggcgctggag--------------------a
                          *   **                 *                        

A0A2R8ZJX9_BCL2A1-      tacgacagcagattgccccggatgtggatacttataaggagatttcat--
A0A2R8ZJX9_BCL2A1-      tacgacagcagattgccccggatgtggatacttataaggagatttcat--
A0A2R8ZJX9_BCL2A1-      tacgacagcagattgccccggatgtggatacttataaggagatttcat--
A0A2R9A7B2_BCL2L2-      tgc----actgtgtgctgagagtgt------caacaaggagatggaacca
A0A2R9A7B2_BCL2L2-      tgc----actgtgtgctgagagtgt------caacaaggagatggaacca
A0A2R9BCD9_BCL2L10      tccagccgcggctaaaggag-----------caggagggcgacgtcgccc
A0A2R9APW6_BCL2-01      cat-------gtgtgtggagagcgt------caaccgggagatgtcgccc
A0A2R9BYH6_MCL1-02      ccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttc
A0A2R9BYH6_MCL1-03      ccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttc
A0A2R9BYH6_MCL1-01      ccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttc
                                  *                           * **        

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ctggt--------------gggacaagtgcagga----------------
A0A2R9A7B2_BCL2L2-      ctggt--------------gggacaagtgcagga----------------
A0A2R9BCD9_BCL2L10      -------------------gggactgccagcgcc----------------
A0A2R9APW6_BCL2-01      ctgg---------------tggac-aacatcgcc----------------
A0A2R9BYH6_MCL1-02      caa-----------------------------------------------
A0A2R9BYH6_MCL1-03      caaggcatgcttcggaaactggac-atcaaaaacgaagacgatgtgaaat
A0A2R9BYH6_MCL1-01      caaggcatgcttcggaaactggac-atcaaaaacgaagacgatgtgaaat

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-03      cgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactgg
A0A2R9BYH6_MCL1-01      cgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactgg

A0A2R8ZJX9_BCL2A1-      -------------------attttgttgcggagttcataatgaataacac
A0A2R8ZJX9_BCL2A1-      -------------------attttgttgcggagttcataatgaataacac
A0A2R8ZJX9_BCL2A1-      -------------------attttgttgcggagttcataatgaataacac
A0A2R9A7B2_BCL2L2-      ------------------------gtggatggtggcctacctggagacgc
A0A2R9A7B2_BCL2L2-      ------------------------gtggatggtggcctacctggagacgc
A0A2R9BCD9_BCL2L10      -----------------tggtggccttgctgagctcgcggctcgtggggc
A0A2R9APW6_BCL2-01      ----------------------ctgtggatgactgagtacctgaaccggc
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-03      ggcaggattgtgactctcatttcttttggtgcctttgtggctaaa----c
A0A2R9BYH6_MCL1-01      ggcaggattgtgactctcatttcttttggtgcctttgtggctaaa----c

A0A2R8ZJX9_BCL2A1-      aggagaatggataagacaaaac----------------------------
A0A2R8ZJX9_BCL2A1-      aggagaatggataagacaaaac----------------------------
A0A2R8ZJX9_BCL2A1-      aggagaatggataagacaaaac----------------------------
A0A2R9A7B2_BCL2L2-      ggctggctgactggatccacagcagt------------------------
A0A2R9A7B2_BCL2L2-      ggctggctgactggatccacagcagt------------------------
A0A2R9BCD9_BCL2L10      agcaccgcgcctggctgcaggctcag------------------------
A0A2R9APW6_BCL2-01      acctgcacacctggatccaggataac------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-03      acttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagt
A0A2R9BYH6_MCL1-01      acttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagt

A0A2R8ZJX9_BCL2A1-      ------------------------------------------------gg
A0A2R8ZJX9_BCL2A1-      ------------------------------------------------gg
A0A2R8ZJX9_BCL2A1-      ------------------------------------------------gg
A0A2R9A7B2_BCL2L2-      ------------------------------------------------gg
A0A2R9A7B2_BCL2L2-      ------------------------------------------------gg
A0A2R9BCD9_BCL2L10      ------------------------------------------------gg
A0A2R9APW6_BCL2-01      ------------------------------------------------gg
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-03      atcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
A0A2R9BYH6_MCL1-01      atcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag

A0A2R8ZJX9_BCL2A1-      aggctggggg--aaatggc---------acaatc--------acacgcct
A0A2R8ZJX9_BCL2A1-      aggct-ggga--aaatggctttgtaaagaagttt--------gaacataa
A0A2R8ZJX9_BCL2A1-      aggct-ggga--aaatggctttgtaaagaagttt--------gaacataa
A0A2R9A7B2_BCL2L2-      gggctgggagctggaagctatcaaagctcgagtcagggagatgga---gg
A0A2R9A7B2_BCL2L2-      gggctgggcg------gagttcacagctctatacggggacggggccctgg
A0A2R9BCD9_BCL2L10      cggctgggat------ggcttttgtcacttcttc-------aggacccc-
A0A2R9APW6_BCL2-01      aggctgggat------gcctttgtggaactgtac--------ggccccag
A0A2R9BYH6_MCL1-02      ------ggat------gggtttgtggagttcttccatgtagaggacctag
A0A2R9BYH6_MCL1-03      aggctgggat------gggtttgtggagttcttccatgtagaggacctag
A0A2R9BYH6_MCL1-01      aggctgggat------gggtttgtggagttcttccatgtagaggacctag
                              **        *                                 

A0A2R8ZJX9_BCL2A1-      a-------------------------------------------------
A0A2R8ZJX9_BCL2A1-      a-------------------------------------------------
A0A2R8ZJX9_BCL2A1-      a-------------------------------------------------
A0A2R9A7B2_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
A0A2R9A7B2_BCL2L2-      aggaggcgcggcgtctgcgggag---------------gggaactgggca
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      cat-------gcggcctctg------------------------------
A0A2R9BYH6_MCL1-02      aag-------gtggcatcaggaa---------------------------
A0A2R9BYH6_MCL1-03      aag-------gtggcatcaggaa---------------------------
A0A2R9BYH6_MCL1-01      aag-------gtggcatcaggaa---------------------------

A0A2R8ZJX9_BCL2A1-      -----------------------tgctggtagagtcag------------
A0A2R8ZJX9_BCL2A1-      -----------------------t-ctggctggatgac------------
A0A2R8ZJX9_BCL2A1-      -----------------------t-ctggctggatgac------------
A0A2R9A7B2_BCL2L2-      aatatgagtccaccaccaggcaatgctggcccagtgatcatgtccattga
A0A2R9A7B2_BCL2L2-      tcagtgag----------gacagtgctgac--------------------
A0A2R9BCD9_BCL2L10      ------ctttc------------cgctggc--------------------
A0A2R9APW6_BCL2-01      --tttgatttc------------tcctggc--------------------
A0A2R9BYH6_MCL1-02      --tgtg----c------------tgctggc--------------------
A0A2R9BYH6_MCL1-03      --tgtg----c------------tgctggc--------------------
A0A2R9BYH6_MCL1-01      --tgtg----c------------tgctggc--------------------

A0A2R8ZJX9_BCL2A1-      ------------------------------------tggcccacaagaag
A0A2R8ZJX9_BCL2A1-      ------------------------------------ttttctagaagtta
A0A2R8ZJX9_BCL2A1-      ------------------------------------ttttctagaagtta
A0A2R9A7B2_BCL2L2-      ggagaagatggaggctgatgcccgttccatctatgttggcaatgtggact
A0A2R9A7B2_BCL2L2-      ---------gggggccg-------------------tggcactgggggcc
A0A2R9BCD9_BCL2L10      ------------------------------------t-ttttggagaaaa
A0A2R9APW6_BCL2-01      ------------------------------------tgtctctgaagact
A0A2R9BYH6_MCL1-02      ------------------------------------t---tttgcaggtg
A0A2R9BYH6_MCL1-03      ------------------------------------t---tttgcaggtg
A0A2R9BYH6_MCL1-01      ------------------------------------t---tttgcaggtg

A0A2R8ZJX9_BCL2A1-      agg-----------------------------------------------
A0A2R8ZJX9_BCL2A1-      cag-----------------------------------------------
A0A2R8ZJX9_BCL2A1-      cag-----------------------------------------------
A0A2R9A7B2_BCL2L2-      atggtgcaacagcagaagagctggaagctcactttcatggctgtggttca
A0A2R9A7B2_BCL2L2-      ctggt---------------------------------------------
A0A2R9BCD9_BCL2L10      cagctggtccag--------------------------------------
A0A2R9APW6_BCL2-01      ctgctcagtttg--------------------------------------
A0A2R9BYH6_MCL1-02      ttgctggagtag--------------------------------------
A0A2R9BYH6_MCL1-03      ttgctggagtag--------------------------------------
A0A2R9BYH6_MCL1-01      ttgctggagtag--------------------------------------

A0A2R8ZJX9_BCL2A1-      -----------------aaaatggc-------------------------
A0A2R8ZJX9_BCL2A1-      -----------------gaaagatctcaatactgttgaccagaaaggaca
A0A2R8ZJX9_BCL2A1-      -----------------gaaagatc-------------------------
A0A2R9A7B2_BCL2L2-      gtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagg
A0A2R9A7B2_BCL2L2-      ---------------------------aactgtaggggcctt--------
A0A2R9BCD9_BCL2L10      -----------------gcttttctgtcatgcttgt------taacaaca
A0A2R9APW6_BCL2-01      -----------------gc-----------cctggtgggagcttgcatca
A0A2R9BYH6_MCL1-02      -----------------ga-----------gctggt------ttg-----
A0A2R9BYH6_MCL1-03      -----------------ga-----------gctggt------ttg-----
A0A2R9BYH6_MCL1-01      -----------------ga-----------gctggt------ttg-----

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      c-------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      gtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttgg
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      gccttcatttatc-------------------------------------
A0A2R9APW6_BCL2-01      ccctgggtgccta-------------------------------------
A0A2R9BYH6_MCL1-02      --------gcata-------------------------------------
A0A2R9BYH6_MCL1-03      --------gcata-------------------------------------
A0A2R9BYH6_MCL1-01      --------gcata-------------------------------------

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ccttagatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaa
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      cgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagc
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattct
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
A0A2R9BYH6_MCL1-01      --------------------------------------------------

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      -------tccatattgtgaaaccggcctaatttttctgactgttatggaa
A0A2R8ZJX9_BCL2A1-      --------------tgtgaaat---gctatctctcct----------gaa
A0A2R9A7B2_BCL2L2-      acagtggttttaacagcaggccccggggtcgcgtctacaggggccgggct
A0A2R9A7B2_BCL2L2-      -------ttttgctagcaag------------------------------
A0A2R9BCD9_BCL2L10      -------tctg--------gacacgattatta------------------
A0A2R9APW6_BCL2-01      -------tctgggccacaagtga---------------------------
A0A2R9BYH6_MCL1-02      -------tcta----ataagatagccttactg------------------
A0A2R9BYH6_MCL1-03      -------tcta----ataagatag--------------------------
A0A2R9BYH6_MCL1-01      -------tcta----ataagatag--------------------------

A0A2R8ZJX9_BCL2A1-      -----------------------tttgtaa
A0A2R8ZJX9_BCL2A1-      acgattgccaacacatacttctacttttaa
A0A2R8ZJX9_BCL2A1-      gcaa-----------------tactgttga
A0A2R9A7B2_BCL2L2-      agagcgacatcatggtattccccttactaa
A0A2R9A7B2_BCL2L2-      ---------------------------tga
A0A2R9BCD9_BCL2L10      ---------------------------tga
A0A2R9APW6_BCL2-01      ------------------------------
A0A2R9BYH6_MCL1-02      ---------------------------taa
A0A2R9BYH6_MCL1-03      ------------------------------
A0A2R9BYH6_MCL1-01      ------------------------------

© 1998-2019