Dataset for CDS BCL-2-like of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8ZJX9_BCL2A1-      atgacagactgtgaatttggat--------atatttacaggctggctcag
A0A2R8ZJX9_BCL2A1-      atgacagactgtgaatttggat--------atatttacaggctggctcag
A0A2R8ZJX9_BCL2A1-      atgacagactgtgaatttggat--------atatttacaggctggctcag
A0A2R9A7B2_BCL2L2-      atggcgaccc--cagcctcagc---cccagacacacgggctctggtggca
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      atggcgaccc--cagcctcagc---cccagacacacgggctctggtggca
A0A2R9BCD9_BCL2L10      atggttgaccagtggcgtgagcgcactaccatggccga------------
A0A2R9APW6_BCL2-01      atggcgcacg--ctgggagaacagggtacgataaccgggagatagtgatg
A0A2R9BYH6_MCL1-02      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R9BYH6_MCL1-01      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R9BYH6_MCL1-03      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
                                                                          

A0A2R8ZJX9_BCL2A1-      gactatctgcagtacgtcctacagataccacaacctggatcaggtccaag
A0A2R8ZJX9_BCL2A1-      gactatctgcagtacgtcctacagataccacaacctggatcaggtccaag
A0A2R8ZJX9_BCL2A1-      gactatctgcagtacgtcctacagataccacaacctggatcaggtccaag
A0A2R9A7B2_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgtggagctgg
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgtggagctgg
A0A2R9BCD9_BCL2L10      -----------------cccgctgcgggagcgcaccgagc-ggttgctgg
A0A2R9APW6_BCL2-01      aagtacatccattataagctgtcgcagaggggctacgagtgggatgcggg
A0A2R9BYH6_MCL1-02      ------actcaacct---ctactgtgggggggc--cggcttgggggccgg
A0A2R9BYH6_MCL1-01      ------actcaacct---ctactgtgggggggc--cggcttgggggccgg
A0A2R9BYH6_MCL1-03      ------actcaacct---ctactgtgggggggc--cggcttgggggccgg
                                                                          

A0A2R8ZJX9_BCL2A1-      ccaaacgtccagagtgctac-------aaaatgttgcattctcagtccaa
A0A2R8ZJX9_BCL2A1-      ccaaacgtccagagtgctac-------aaaatgttgcattctcagtccaa
A0A2R8ZJX9_BCL2A1-      ccaaacgtccagagtgctac-------aaaatgttgcattctcagtccaa
A0A2R9A7B2_BCL2L2-      ccc-----cggggagggcccagcagctgacccgctgc-------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ccc-----cggggagggcccagcagctgacccgctgc-------------
A0A2R9BCD9_BCL2L10      ccgactacctggggtactgcgcccgggaacccggcac-------------
A0A2R9APW6_BCL2-01      aga-----tgtgggcgccgcgcccctcagcccggtgccacctgtgg----
A0A2R9BYH6_MCL1-02      cag-----cggcggcgccacccctccggg---agggcgacttttggctac
A0A2R9BYH6_MCL1-01      cag-----cggcggcgccacccctccggg---agggcgacttttggctac
A0A2R9BYH6_MCL1-03      cag-----cggcggcgccacccctccggg---agggcgactttt------
                                                                          

A0A2R8ZJX9_BCL2A1-      aaagaagtgga---------------------------------------
A0A2R8ZJX9_BCL2A1-      aaagaagtgga---------------------------------------
A0A2R8ZJX9_BCL2A1-      aaagaagtgga---------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      ggagaaggaggcctcggcccggcgagagatagggggaggggaggccggcg
A0A2R9BYH6_MCL1-01      ggagaaggaggcctcggcccggcgagagatagggggaggggaggccggcg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      ---------------------------------------------aaaga
A0A2R8ZJX9_BCL2A1-      ---------------------------------------------aaaga
A0A2R8ZJX9_BCL2A1-      ---------------------------------------------aaaga
A0A2R9A7B2_BCL2L2-      ----------------------------------accaagccatgcgggc
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ----------------------------------accaagccatgcgggc
A0A2R9BCD9_BCL2L10      ---------------------------------------------ccccg
A0A2R9APW6_BCL2-01      -------------------------------tccacctgaccctccgcca
A0A2R9BYH6_MCL1-02      cggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgcca
A0A2R9BYH6_MCL1-01      cggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgcca
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      atctgaagtcatgcttggacaatgttaatgt-------------------
A0A2R8ZJX9_BCL2A1-      atctgaagtcatgcttggacaatgttaatgt-------------------
A0A2R8ZJX9_BCL2A1-      atctgaagtcatgcttggacaatgttaatgt-------------------
A0A2R9A7B2_BCL2L2-      agctggagatgagttcgagacccgcttccggcgcaccttctctgatctgg
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      agctggagatgagttcgagacccgcttccggcgcaccttctctgatctgg
A0A2R9BCD9_BCL2L10      agccgacgccgtccacgcccgaggccgcc-----gtgc------------
A0A2R9APW6_BCL2-01      ggccggcgacgacttctcccgccgctacc---------------------
A0A2R9BYH6_MCL1-02      gactcccggagggtcgcgcggccgccgcccattggcgc------------
A0A2R9BYH6_MCL1-01      gactcccggagggtcgcgcggccgccgcccattggcgc------------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      -------------tgtgtctgtagacactgccagaacactattcaacca-
A0A2R8ZJX9_BCL2A1-      -------------tgtgtctgtagacactgccagaacactattcaacca-
A0A2R8ZJX9_BCL2A1-      -------------tgtgtctgtagacactgccagaacactattcaacca-
A0A2R9A7B2_BCL2L2-      cggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccag
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      cggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccag
A0A2R9BCD9_BCL2L10      -------------tgcgctccgcggc--cgccaggttacggcagatccac
A0A2R9APW6_BCL2-01      ------------------gccgcgacttcgccgagatgtcc---agccag
A0A2R9BYH6_MCL1-02      -------------cgaggtccccgacgtcaccgcgacccccgcgaggctg
A0A2R9BYH6_MCL1-01      -------------cgaggtccccgacgtcaccgcgacccccgcgaggctg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      gtctccgatgaactttttcaagggggccccaactggggccgccttgtagc
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      gtctccgatgaactttttcaagggggccccaactggggccgccttgtagc
A0A2R9BCD9_BCL2L10      cggtccttcttctccgcctacctcggctaccccgggaaccgc--------
A0A2R9APW6_BCL2-01      ctgcacctgacgccc-ttcaccgcg--------cggggacgc--------
A0A2R9BYH6_MCL1-02      cttttcttcgcgcccacccgccgcg--------cggcgccgc--------
A0A2R9BYH6_MCL1-01      cttttcttcgcgcccacccgccgcg--------cggcgccgc--------
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      cttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggaga
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      cttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggaga
A0A2R9BCD9_BCL2L10      -----------------tt--------------------------cgagc
A0A2R9APW6_BCL2-01      -----------------tt--------------------------tgcca
A0A2R9BYH6_MCL1-02      -----------------ttgaggagatggaagccccggccgccgacgcca
A0A2R9BYH6_MCL1-01      -----------------ttgaggagatggaagccccggccgccgacgcca
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      ----agtgatggaaaaggagtttgaaga----------------------
A0A2R8ZJX9_BCL2A1-      ----agtgatggaaaaggagtttgaaga----------------------
A0A2R8ZJX9_BCL2A1-      ----agtgatggaaaaggagtttgaaga----------------------
A0A2R9A7B2_BCL2L2-      tggaaccactggtgggacaagtgcaggagtggatggtggcctacctggag
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      tggaaccactggtgggacaagtgcaggagtggatggtggcctacctggag
A0A2R9BCD9_BCL2L10      tggtggcgctgatggcggattc----------------------------
A0A2R9APW6_BCL2-01      cggtggtg------gaggagct----------------------------
A0A2R9BYH6_MCL1-02      tcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcggg
A0A2R9BYH6_MCL1-01      tcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcggg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      acgcggctggctgactggatccacagcagtgggggctgggcg--------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      acgcggctggctgactggatccacagcagtgggggctgggagctggaagc
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      aagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaa
A0A2R9BYH6_MCL1-01      aagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaa
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ----------------------atggaggaagaagctgagaagctaaagg
A0A2R9A7B2_BCL2L2-      tatcaaagctcgagtcagggagatggaggaagaagctgagaagctaaagg
A0A2R9BCD9_BCL2L10      -----------cgtgctctccgacagccccggccccacctggggcagagt
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      taacaccagtacggacgggtcactaccctcgacgccgccgccagcagagg
A0A2R9BYH6_MCL1-01      taacaccagtacggacgggtcactaccctcgacgccgccgccagcagagg
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      ----------------------------------gagttcacagct---c
A0A2R9A7B2_BCL2L2-      agctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggc
A0A2R9A7B2_BCL2L2-      agctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggc
A0A2R9BCD9_BCL2L10      gg-----------------------------------tgacgctcgtgac
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      aggaggaggacgagttgtaccggcagtcgctggagattatctctcggtac
A0A2R9BYH6_MCL1-01      aggaggaggacgagttgtaccggcagtcgctggagattatctctcggtac
A0A2R9BYH6_MCL1-03      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      -----------------tggcatcattaac----------tggggaagaa
A0A2R8ZJX9_BCL2A1-      -----------------tggcatcattaac----------tggggaagaa
A0A2R8ZJX9_BCL2A1-      -----------------tggcatcattaac----------tggggaagaa
A0A2R9A7B2_BCL2L2-      tatacggggacgg-------ggccctgga------ggaggcg-cggcgtc
A0A2R9A7B2_BCL2L2-      aatgctggcccagtgatcatgtccattga------ggagaagatggaggc
A0A2R9A7B2_BCL2L2-      aatgctggcccagtgatcatgtccattga------ggagaagatggaggc
A0A2R9BCD9_BCL2L10      cttcg------------------cagggacgctgctggagagagggccgc
A0A2R9APW6_BCL2-01      --------------------cttcagggacgggg-tgaactgggggagga
A0A2R9BYH6_MCL1-02      cttcgggagcaggccaccggcgccaaggacacaa-agccaatgggcaggt
A0A2R9BYH6_MCL1-01      cttcgggagcaggccaccggcgccaaggacacaa-agccaatgggcaggt
A0A2R9BYH6_MCL1-03      -----------ggccaccggcgccaaggacacaa-agccaatgggcaggt
                                               *    *               *     

A0A2R8ZJX9_BCL2A1-      ttgtaaccat------------------------------------attt
A0A2R8ZJX9_BCL2A1-      ttgtaaccat------------------------------------attt
A0A2R8ZJX9_BCL2A1-      ttgtaaccat------------------------------------attt
A0A2R9A7B2_BCL2L2-      tg------------------------------------------cgggag
A0A2R9A7B2_BCL2L2-      tgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcag
A0A2R9A7B2_BCL2L2-      tgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcag
A0A2R9BCD9_BCL2L10      tggtgaccac----------------------------------ccggtg
A0A2R9APW6_BCL2-01      ttgtggcctt----------------------------------c--ttt
A0A2R9BYH6_MCL1-02      ctggggccac----------------------------------cagcag
A0A2R9BYH6_MCL1-01      ctggggccac----------------------------------cagcag
A0A2R9BYH6_MCL1-03      ctggggccac----------------------------------cagcag
                                                                          

A0A2R8ZJX9_BCL2A1-      gcatttgaaggtattct---------------------------------
A0A2R8ZJX9_BCL2A1-      gcatttgaaggtattct---------------------------------
A0A2R8ZJX9_BCL2A1-      gcatttgaaggtattct---------------------------------
A0A2R9A7B2_BCL2L2-      gggaactgg-----------------------------------------
A0A2R9A7B2_BCL2L2-      aagagctggaagctcactttcatggctgtggttcagtcaaccgtgttacc
A0A2R9A7B2_BCL2L2-      aagagctggaagctcactttcatggctgtggttcagtcaaccgtgttacc
A0A2R9BCD9_BCL2L10      gaagaagtggggcttccagccgcggct-----------------------
A0A2R9APW6_BCL2-01      gagttcggtggggtcat-------gtg-----------------------
A0A2R9BYH6_MCL1-02      gaaggcgctggagaccttacgacgggt-----------------------
A0A2R9BYH6_MCL1-01      gaaggcgctggagaccttacgacgggt-----------------------
A0A2R9BYH6_MCL1-03      gaaggcgctggagaccttacgacgggt-----------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      ------------------------catcaagaaacttctacgacagcaga
A0A2R8ZJX9_BCL2A1-      ------------------------catcaagaaacttctacgacagcaga
A0A2R8ZJX9_BCL2A1-      ------------------------catcaagaaacttctacgacagcaga
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      atactctgtgacaaatttagtggccatcccaaagggtttgcgtatataga
A0A2R9A7B2_BCL2L2-      atactctgtgacaaatttagtggccatcccaaagggtttgcgtatataga
A0A2R9BCD9_BCL2L10      ------aaaggag-----------caggagggcgacgtcgccc-------
A0A2R9APW6_BCL2-01      ------tgtggagagcgt------caaccgggagatgtcgcccctgg---
A0A2R9BYH6_MCL1-02      ------tggggatggcgtgcagcgcaaccatgagacggccttccaa----
A0A2R9BYH6_MCL1-01      ------tggggatggcgtgcagcgcaaccatgagacggccttccaaggca
A0A2R9BYH6_MCL1-03      ------tggggatggcgtgcagcgcaaccatgagacggccttccaaggca
                                                                          

A0A2R8ZJX9_BCL2A1-      ttgccccggatgtggatacttataagg-----------------------
A0A2R8ZJX9_BCL2A1-      ttgccccggatgtggatacttataagg-----------------------
A0A2R8ZJX9_BCL2A1-      ttgccccggatgtggatacttataagg-----------------------
A0A2R9A7B2_BCL2L2-      -------------gcatcagtgaggac-----------------------
A0A2R9A7B2_BCL2L2-      gttctcagacaaagagtcagtgaggac-----------------------
A0A2R9A7B2_BCL2L2-      gttctcagacaaagagtcagtgaggac-----------------------
A0A2R9BCD9_BCL2L10      ------------gggactgccagcgcc-----------------------
A0A2R9APW6_BCL2-01      ------------tggac-aacatcgcc-----------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-01      tgcttcggaaactggac-atcaaaaacgaagacgatgtgaaatcgttgtc
A0A2R9BYH6_MCL1-03      tgcttcggaaactggac-atcaaaaacgaagacgatgtgaaatcgttgtc
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-01      tcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcagga
A0A2R9BYH6_MCL1-03      tcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcagga
                                                                          

A0A2R8ZJX9_BCL2A1-      ---agatttcatattttgttgcggagttcataatgaa-------------
A0A2R8ZJX9_BCL2A1-      ---agatttcatattttgttgcggagttcataatgaa-------------
A0A2R8ZJX9_BCL2A1-      ---agatttcatattttgttgcggagttcataatgaa-------------
A0A2R9A7B2_BCL2L2-      ------------------------agtgct------gacgggggcc----
A0A2R9A7B2_BCL2L2-      -------ttccttggccttagatgagtccctatttagaggaaggcaaatc
A0A2R9A7B2_BCL2L2-      -------ttccttggccttagatgagtccctatttagaggaaggcaaatc
A0A2R9BCD9_BCL2L10      ----------tggtggccttgctgagctcgcggctcgtggg---------
A0A2R9APW6_BCL2-01      ---------------ctgtggatgactgagtacctgaaccg---------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-01      ttgtgactctcatttcttttggtgcctttgtggctaaa------------
A0A2R9BYH6_MCL1-03      ttgtgactctcatttcttttggtgcctttgtggctaaa------------
                                                                          

A0A2R8ZJX9_BCL2A1-      ----------------taacacaggagaatggataagacaaaac------
A0A2R8ZJX9_BCL2A1-      ----------------taacacaggagaatggataagacaaaac------
A0A2R8ZJX9_BCL2A1-      ----------------taacacaggagaatggataagacaaaac------
A0A2R9A7B2_BCL2L2-      ---gtg----------gcactgggggccctggtaactgta----------
A0A2R9A7B2_BCL2L2-      aaggtgatcccaaaacgaaccaacagaccaggcatcagcacaac------
A0A2R9A7B2_BCL2L2-      aaggtgatcccaaaacgaaccaacagaccaggcatcagcacaac------
A0A2R9BCD9_BCL2L10      ----------------gcagcaccgcgcctggctgcaggctcag------
A0A2R9APW6_BCL2-01      ----------------gcacctgcacacctggatccaggataac------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-01      -----------------cacttgaagaccataaaccaagaaagctgcatc
A0A2R9BYH6_MCL1-03      -----------------cacttgaagaccataaaccaagaaagctgcatc
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BYH6_MCL1-02      --------------------------------------------------
A0A2R9BYH6_MCL1-01      gaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacggga
A0A2R9BYH6_MCL1-03      gaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacggga
                                                                          

A0A2R8ZJX9_BCL2A1-      ----------------ggaggctgggggaaatggc---------acaatc
A0A2R8ZJX9_BCL2A1-      ----------------ggaggct-gggaaaatggctttgtaaagaagttt
A0A2R8ZJX9_BCL2A1-      ----------------ggaggct-gggaaaatggctttgtaaagaagttt
A0A2R9A7B2_BCL2L2-      -----------------------ggg----gcctt---------------
A0A2R9A7B2_BCL2L2-      ------------------agaccggg----gttttccacgagcccgctac
A0A2R9A7B2_BCL2L2-      ------------------agaccggg----gttttccacgagcccgctac
A0A2R9BCD9_BCL2L10      ----------------ggcggctggg----atggcttttgtcacttcttc
A0A2R9APW6_BCL2-01      ----------------ggaggctggg----atgcctttgtggaactgtac
A0A2R9BYH6_MCL1-02      ------------------------gg----atgggtttgtggagttcttc
A0A2R9BYH6_MCL1-01      ctggctagttaaacaaagaggctggg----atgggtttgtggagttcttc
A0A2R9BYH6_MCL1-03      ctggctagttaaacaaagaggctggg----atgggtttgtggagttcttc
                                                **                        

A0A2R8ZJX9_BCL2A1-      --------acacgcctatgctggtag----------------agtcagtg
A0A2R8ZJX9_BCL2A1-      --------gaacataaat-ctggctg----------------gatgactt
A0A2R8ZJX9_BCL2A1-      --------gaacataaat-ctggctg----------------gatgactt
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      cgcgcccggaccaccaactacaacagttcccgctctcgattctacagtgg
A0A2R9A7B2_BCL2L2-      cgcgcccggaccaccaactacaacagttcccgctctcgattctacagtgg
A0A2R9BCD9_BCL2L10      -------aggacccc---------------------ctttccgctggct-
A0A2R9APW6_BCL2-01      --------ggccccagcatgcggcctctg---tttgatttctcctggctg
A0A2R9BYH6_MCL1-02      catgtagaggacctagaaggtggcatcaggaatgtg----ctgctggct-
A0A2R9BYH6_MCL1-01      catgtagaggacctagaaggtggcatcaggaatgtg----ctgctggct-
A0A2R9BYH6_MCL1-03      catgtagaggacctagaaggtggcatcaggaatgtg----ctgctggct-
                                                                          

A0A2R8ZJX9_BCL2A1-      gcccacaagaagaggaaaatggc---------------------------
A0A2R8ZJX9_BCL2A1-      ttctagaagttacaggaaagatctcaatactgttgaccagaaaggacact
A0A2R8ZJX9_BCL2A1-      ttctagaagttacaggaaagatc---------------------------
A0A2R9A7B2_BCL2L2-      ttttgctagcaag-------------------------------------
A0A2R9A7B2_BCL2L2-      ttttaacagcaggccccggggtc---------------------------
A0A2R9A7B2_BCL2L2-      ttttaacagcaggccccggggtc---------------------------
A0A2R9BCD9_BCL2L10      ttttggagaaaacagctggtcca---------------------------
A0A2R9APW6_BCL2-01      tctctgaagactctgctcagttt---------------------------
A0A2R9BYH6_MCL1-02      --tttgcaggtgttgctggagta---------------------------
A0A2R9BYH6_MCL1-01      --tttgcaggtgttgctggagta---------------------------
A0A2R9BYH6_MCL1-03      --tttgcaggtgttgctggagta---------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      ccatattgtgaaaccggcctaatttttctgactgttatggaaacgattgc
A0A2R8ZJX9_BCL2A1-      ------tgtgaaat---gctatctctcct----------gaagcaa----
A0A2R9A7B2_BCL2L2-      --------------------------------------------------
A0A2R9A7B2_BCL2L2-      --------------------gcgtctaca--g--gtcaggatag------
A0A2R9A7B2_BCL2L2-      --------------------gcgtctacaggg--gccgggctagagcgac
A0A2R9BCD9_BCL2L10      --------------------ggcttttctgtcatgcttgt------taac
A0A2R9APW6_BCL2-01      --------------------ggc-----------cctggtgggagcttgc
A0A2R9BYH6_MCL1-02      --------------------gga-----------gctggt------ttg-
A0A2R9BYH6_MCL1-01      --------------------gga-----------gctggt------ttg-
A0A2R9BYH6_MCL1-03      --------------------gga-----------gctggt------ttg-
                                                                          

A0A2R8ZJX9_BCL2A1-      ---------------tttgtaa-----------------------
A0A2R8ZJX9_BCL2A1-      caacacatacttctacttttaa-----------------------
A0A2R8ZJX9_BCL2A1-      -------------tactgttga-----------------------
A0A2R9A7B2_BCL2L2-      -------------------tga-----------------------
A0A2R9A7B2_BCL2L2-      ---------------------------------------------
A0A2R9A7B2_BCL2L2-      atcatggtattccccttactaa-----------------------
A0A2R9BCD9_BCL2L10      aacagccttcatttatctctg--------gacacgattattatga
A0A2R9APW6_BCL2-01      atcaccctgggtgcctatctgggccacaagtga------------
A0A2R9BYH6_MCL1-02      ------------gcatatcta----ataagatagccttactgtaa
A0A2R9BYH6_MCL1-01      ------------gcatatcta----ataagatag-----------
A0A2R9BYH6_MCL1-03      ------------gcatatcta----ataagatag-----------
                                                                     

© 1998-2018