Dataset for CDS BCL2L2 of organism Ovis aries

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

W5QDH5_BCL2L2-02      atgggctggccaaacctgaaatacctccttctgggcctctcaccatatat
W5QDH5_BCL2L2-01      atgggctggccaaacctgaaatacctccttctgggcctctcaccatatat

W5QDH5_BCL2L2-02      tcatgccagtcttttatgtttgactccaacagccgcccggatggcgaccc
W5QDH5_BCL2L2-01      tcatgccagtcttttatgtttgactccaacagccgcccggatggcgaccc

W5QDH5_BCL2L2-02      cagcctcagccccagacacacgggctctagtggcagactttgtgggctat
W5QDH5_BCL2L2-01      cagcctcagccccagacacacgggctctagtggcagactttgtgggctat

W5QDH5_BCL2L2-02      aagctgaggcagaaggggtatgtttgtggagctggccccggggagggccc
W5QDH5_BCL2L2-01      aagctgaggcagaaggggtatgtttgtggagctggccccggggagggccc

W5QDH5_BCL2L2-02      agcagctgacccgctacaccaagccatgcgggcagctggagatgagtttg
W5QDH5_BCL2L2-01      agcagctgacccgctacaccaagccatgcgggcagctggagatgagtttg

W5QDH5_BCL2L2-02      agacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtg
W5QDH5_BCL2L2-01      agacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtg

W5QDH5_BCL2L2-02      accccgggttcggcccagcagcgcttcacccaggtctctgatgaactctt
W5QDH5_BCL2L2-01      accccgggttcggcccagcagcgcttcacccaggtctctgatgaactctt

W5QDH5_BCL2L2-02      ccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
W5QDH5_BCL2L2-01      ccaagggggccccaactggggtcgccttgtggccttctttgtctttggag

W5QDH5_BCL2L2-02      ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtggga
W5QDH5_BCL2L2-01      ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtggga

W5QDH5_BCL2L2-02      caagtgcaggagtggatggtggcctacctggagacgcggctggctgactg
W5QDH5_BCL2L2-01      caagtgcaggagtggatggtggcctacctggagacgcggctggctgactg

W5QDH5_BCL2L2-02      gatccacagcagtgggggctgggcg------gagttcacagctcta--ta
W5QDH5_BCL2L2-01      gatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtta
                      *********************** *      * * *** ***** *  **

W5QDH5_BCL2L2-02      cggggacggggccctggaggaggcgcggcgtctgcgggag----------
W5QDH5_BCL2L2-01      gggagatgga-----ggaagaagctgagaagctaaaggagctacagaacg
                       ** ** **      *** ** **   *   **   ****          

W5QDH5_BCL2L2-02      -----gggaa----------------------ctgggc------------
W5QDH5_BCL2L2-01      aggtagagaagcagatgaatatgagtccacctccgggcaatgctggccca
                           * ***                      * ****            

W5QDH5_BCL2L2-02      ---------ttcagtgagga------------------------------
W5QDH5_BCL2L2-01      gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatcta
                               * ** ******                              

W5QDH5_BCL2L2-02      ------cagtgctgacggggg-----------------------------
W5QDH5_BCL2L2-01      tgttggcaatgtggactatggtgcaacagcagaagagctagaagcacact
                            ** **  ***   **                             

W5QDH5_BCL2L2-02      -------------------------------------ccgtggcactttc
W5QDH5_BCL2L2-01      tccatggctgtggttcagtcaaccgcgttactatactctgtgacaaattt
                                                           * *** **  ** 

W5QDH5_BCL2L2-02      gctagc--------------------------------------------
W5QDH5_BCL2L2-01      agtggccatcccaaagggtttgcgtatatagagttctcagacaaagagtc
                        * **                                            

W5QDH5_BCL2L2-02      --tgagggct---ctggccg----------cttttttgcagaaagt----
W5QDH5_BCL2L2-01      agtgaggacttccctggccttagatgaatccttatttagaggaagacaga
                        ***** **   ******           *** ***  ** ***     

W5QDH5_BCL2L2-02      --------------------------------------------------
W5QDH5_BCL2L2-01      tcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagac

W5QDH5_BCL2L2-02      --------------------------------------------------
W5QDH5_BCL2L2-01      cgaggtttcccacgagcccgataccgtgcccgaaccaccaactacaacag

W5QDH5_BCL2L2-02      --------------------------------------------------
W5QDH5_BCL2L2-01      ttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcg

W5QDH5_BCL2L2-02      -----------------------------------------------
W5QDH5_BCL2L2-01      tctacaggggccgggctagagcgacatcatggtattccccttactaa

© 1998-2019