Dataset for CDS BCL-2-like of organism Otolemur garnettii

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       --------------------------------------------------
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         --------------------------------------------------
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         atgtttggcctcaagagaaacgcagtgatcggactcaacctctactgtgg
H0XHA5_MCL1-01         --------------------------------------------------
                                                                         

H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       --------------------------------------------------
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         --------------------------------------------------
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         gggcgccgggctgggggctggcagcggcggcgccacacccccgggagggc
H0XHA5_MCL1-01         --------------------------------------------------
                                                                         

H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       --------------------------------------------------
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         --------------------------------------------------
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         ggcttttggctgcggagaaggaggccgcggcccggcgagaggcaggggga
H0XHA5_MCL1-01         --------------------------------------------------
                                                                         

H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       --------------------------------------------------
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         --------------------------------------------------
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         ggggaagccggcgaggtgattggcggaagccccggcgcgagttccccggc
H0XHA5_MCL1-01         --------------------------------------------------
                                                                         

H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       --------------------------------------------------
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         --------------------------------------------------
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         ctccctcacgccagacgcccggagggtcgcgcggccgccgcccattggtg
H0XHA5_MCL1-01         --------------------------------------------------
                                                                         

H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       -----------------atgtctc--------------------------
H0XR82_BCL2L2-01       -----------------atggcgaccccagcctcagcccca---------
H0WKI0_BCL2-01         -----------------atggcgcacgctgggagaac-------------
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         ccgaagtccccgacgtcaccgcgacccccacgaggctgctgttcttcgcg
H0XHA5_MCL1-01         ---------------------------ctaccagacc-------------
                                                                         

H0WZ23_BCL2A1-01       ------------------------------atgactgactg-----tgag
H0X6V2_BCL2L1-01       ------------------------------agagcaaccgggagctggtg
H0XR82_BCL2L2-01       --------------------------------gacacacgggctctggtg
H0WKI0_BCL2-01         -------------------------agggtatgataaccgggagatagtg
H0WZ06_BCL2L10-01      ------------------------------atggcagac----cc-gttg
H0XFB7_MCL1-01         cccaccctccgtgcggcgccgcgggaggagatggaagcc----cctgccg
H0XHA5_MCL1-01         ----------------------------agatggaagcc----caagttg
                                                             *          *

H0WZ23_BCL2A1-01       tttggatacatt---cacaggctggctcag---gacta----------tc
H0X6V2_BCL2L1-01       gttgactttatctcctacaagctttcccagaaaggataca--------gc
H0XR82_BCL2L2-01       gcagactttgtaggctataagctgaggcagaagggtta------------
H0WKI0_BCL2-01         atgaagtacatccactataagctgtcgcagaggggctacgagtgggatgc
H0WZ06_BCL2L10-01      agggagcgcacc------gagcggctgctgactgacta----------cc
H0XFB7_MCL1-01         ccgacgc-catc------at---gtcgccggaagatga----------gc
H0XHA5_MCL1-01         ccgatgc-cgtc------aa---gtcgcccgaaggtga----------gg
                                                  *     *   *            

H0WZ23_BCL2A1-01       tgcagta-----------------------tgtcctgcaaatacagcaat
H0X6V2_BCL2L1-01       tggagtcagtttagcgatgtggaagagaacaggactgaggccccagaagg
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         tggagacgtgggcgt-----tgcaccccccggggccgccactgcgccggg
H0WZ06_BCL2L10-01      tggagtactgcgcgc-----gggatccgactgccccggagc--cgacg--
H0XFB7_MCL1-01         tggacgggtacgagc-----cggagcctttggggaagcggc--cggcggt
H0XHA5_MCL1-01         tggcctcgtgcgagc-----cggagcctctcaagaagcaac--cggaggg
                                                                         

H0WZ23_BCL2A1-01       gtggatcaggtccaagcaaaa--------------------------cgt
H0X6V2_BCL2L1-01       ---gaatgaatcagagctggagacccccagtgccattaatggcaacccat
H0XR82_BCL2L2-01       -----tgtctgtggagctgg-------------cccagggg------agg
H0WKI0_BCL2-01         cgtcttctcctcccagcccgggcgcacccctactcccgctg------cgc
H0WZ06_BCL2L10-01      -ccgtcctcgcccgaggccg-------------ccttgctg------cgc
H0XFB7_MCL1-01         cctgcctttgctggagttgg---------------tcgggg------agg
H0XHA5_MCL1-01         cctgcctttgctggagtttg---------------ttggtg------agg
                                     **                                  

H0WZ23_BCL2A1-01       ccagagt-------------------------------------------
H0X6V2_BCL2L1-01       cctggcacctggctgaca--------------------------------
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         cccgggacccggccgccaggacctcgcccccggccgcccccgccgccgcc
H0WZ06_BCL2L10-01      tccgtgacc-----------------------------------------
H0XFB7_MCL1-01         ccagtaacg-----------------------------------------
H0XHA5_MCL1-01         ccggtaacg-----------------------------------------
                                                                         

H0WZ23_BCL2A1-01       -----------gctgcaaaat------gttgcattttcagtc--------
H0X6V2_BCL2L1-01       -----------gcccc-acggtgaatggagccac---tggccacagcagc
H0XR82_BCL2L2-01       -----------gcccagcaactgacccgttgcac---caagc--------
H0WKI0_BCL2-01         gccgccgcggagcctctgctcagcccggtgccacctgtggtc--------
H0WZ06_BCL2L10-01      -----------gcctatatacagca--gcgccac---tggtc--------
H0XFB7_MCL1-01         -----------gccccagcactgat--gggtcac---t--tc--------
H0XHA5_MCL1-01         -----------gccccagcactgac--a---cac---t--tc--------
                                  **                  **        *        

H0WZ23_BCL2A1-01       ------------------------------------------------ca
H0X6V2_BCL2L1-01       agtttggatgcccgggaggtgatccccatggcagcagtgaagcaagcact
H0XR82_BCL2L2-01       -------------------------------catgcgggcagct------
H0WKI0_BCL2-01         -------------------------------cacctgaccctccgcc---
H0WZ06_BCL2L10-01      -------------------------------ctttttctccgcctac---
H0XFB7_MCL1-01         -------------------------------cttcgacaccgcccccagc
H0XHA5_MCL1-01         -------------------------------cttccacacctcccccagc
                                                                         

H0WZ23_BCL2A1-01       agaagaggttgaaaagagtctgaaaccatgct-----tagacaattttaa
H0X6V2_BCL2L1-01       gagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtg
H0XR82_BCL2L2-01       ----------ggagatgagttcgagacccgcttccggcgtaccttctctg
H0WKI0_BCL2-01         -----aggcgggcgatgacttctctcgccgctaccgccgcgacttcgccg
H0WZ06_BCL2L10-01      --------------ataggctaccccg--ggaatcg--------------
H0XFB7_MCL1-01         agaggaggaggaggatgagttataccg--gcagtcgctg-gagatcatct
H0XHA5_MCL1-01         a---gaggaggaggatgagttatactg--gcagtcgatg-gagatcatct
                                     *     *        *                    

H0WZ23_BCL2A1-01       tgttgtatccatagatact-------------------------------
H0X6V2_BCL2L1-01       acctgacatctcagctgca-------------------------------
H0XR82_BCL2L2-01       atctggcagctcagctaca-------------------------------
H0WKI0_BCL2-01         agatgtccagccagttgca-------------------------------
H0WZ06_BCL2L10-01      -------cgttcaggtggt-------------------------------
H0XFB7_MCL1-01         ctcggtaccttcgggagcaggcgaccggtgccaaggacgcgaaaccaatg
H0XHA5_MCL1-01         ctcggtacctatgggagca-------------------------------
                                    *                                    

H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       ------------------------------catcaccccagggacagca-
H0XR82_BCL2L2-01       ------------------------------tgtgaccccaggctcagcc-
H0WKI0_BCL2-01         ------------------------------cctgacgcccttcaccgcg-
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         ggcagggcaggagccgccagcaggaaggcgctggagaccttgcgccgcgt
H0XHA5_MCL1-01         --------------------------------------------------
                                                                         

H0WZ23_BCL2A1-01       --------------------------------------------------
H0X6V2_BCL2L1-01       --------------------------------------------------
H0XR82_BCL2L2-01       --------------------------------------------------
H0WKI0_BCL2-01         --------------------------------------------------
H0WZ06_BCL2L10-01      --------------------------------------------------
H0XFB7_MCL1-01         tggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttc
H0XHA5_MCL1-01         --------------------------------------------------
                                                                         

H0WZ23_BCL2A1-01       --------------------------gccagaacaatattcaatcaagtg
H0X6V2_BCL2L1-01       ----------------------------tatcagagctttgaacag-gta
H0XR82_BCL2L2-01       ----------------------------cagcaacgcttcacccaggtct
H0WKI0_BCL2-01         agag----------------------------gacgctttgccacg-gtg
H0WZ06_BCL2L10-01      ggaa----------------------------------------cggatg
H0XFB7_MCL1-01         ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
H0XHA5_MCL1-01         ggaaactgg-------------agaggatatcaactctttgtctcgagtg
                                                                         

H0WZ23_BCL2A1-01       atggaaaaggaatttgaag---atggcatcattaactggggcaggattgt
H0X6V2_BCL2L1-01       gtg--aacgaactcttccg----ggatggggtaaactggggtcgaattgt
H0XR82_BCL2L2-01       ctg--atgaacttttccaa-----gggggccccaactggggccgccttgt
H0WKI0_BCL2-01         gtg--gaggagctcttcag----ggatggggtgaactgggggaggatcgt
H0WZ06_BCL2L10-01      gtgaaggctatgctctcagacaaccagagactcaactggggccgagtggt
H0XFB7_MCL1-01         atg--gtccatgttttcag-tgacggcgtaacaaactggggcaggattgt
H0XHA5_MCL1-01         atg--gcccatgttttcag-ttacggcgtaacaaattggggcaggattat
                        **                              ** *****  *  *  *

H0WZ23_BCL2A1-01       gacaatatttgcctttggaggtattctcctcaagaaacttctcca-acag
H0X6V2_BCL2L1-01       ggcctttttctccttcg----------------gc-----------gggg
H0XR82_BCL2L2-01       ggccttcttcgtctttg----------------gg-----------gccg
H0WKI0_BCL2-01         ggccttctttgagttcg----------------gt-----------gggg
H0WZ06_BCL2L10-01      gacgctcgtgaccttcgcagggacgcttctacagaggcctccagtagaag
H0XFB7_MCL1-01         gactctaatttcttttg----------------gtgccttt-----gtgg
H0XHA5_MCL1-01         gaccctaat---ttttg----------------gtggcttt-----gtgg
                       * *  *  *    ** *                *               *

H0WZ23_BCL2A1-01       cgaattgccctgga-tgtggatact--------------tataaggagat
H0X6V2_BCL2L1-01       ctctgtgcgtggaa-agcgtagaca------------------aggagat
H0XR82_BCL2L2-01       cactgtgtgctgag-agtgtcaaca------------------aggagat
H0WKI0_BCL2-01         tcatgtgtgtggag-agcgtcaacc------------------gggagat
H0WZ06_BCL2L10-01      ccaggcgggagaagcaggacaagtcgcaactgaaggagggagaagacgaa
H0XFB7_MCL1-01         ccaaacacttgaag-agcataaacc--------------aagaaagctgc
H0XHA5_MCL1-01         ccaagcacctgaag-accataaacc--------------aagaaggctac
                                                                         

H0WZ23_BCL2A1-01       ttc------------------------ttattttgttgctgagttcataa
H0X6V2_BCL2L1-01       g-------caggtattggtgagtcggatcgcagcttggatggccacttac
H0XR82_BCL2L2-01       g-------gagccactggtgggacaagtgcaggagtggatggtagcctac
H0WKI0_BCL2-01         gtc-------gcccctggtggacaacatcgccctgtggatgactgagtac
H0WZ06_BCL2L10-01      gtcgccagggattgccagcgcctagtggccc-----tactgagctctcgg
H0XFB7_MCL1-01         atc-----gaaccattagcagaaagtatcac-----agacgttct-----
H0XHA5_MCL1-01         atc-----aaaccgctagaagaaaatatcgc-----agatgtcct-----
                                                               *         

H0WZ23_BCL2A1-01       tgaattacacagga----gaatggataaggcaaaatggaggctggg----
H0X6V2_BCL2L1-01       ttgaatgaccacctagagccttggatccaggagaacggcggctggtggag
H0XR82_BCL2L2-01       ctggagacacggctggctgactggatccatagcagtggtggctggg----
H0WKI0_BCL2-01         ctgaaccggcacctgcacacctggatccaggataacggaggctggg----
H0WZ06_BCL2L10-01      ctggtggggcagcaccgcgtttggctggaggctcaaggcggctggg----
H0XFB7_MCL1-01         -tgtaaggacaaaacgg-gactggctagtcaaacaaagaggctggg----
H0XHA5_MCL1-01         -tgtgaggacaaaaccg-gactggctagtcaaacaacgaggctggg----
                                *           *** *           * ******     

H0WZ23_BCL2A1-01       --aacatggctttgtaaagaagtttgaacctaactctggctactctggct
H0X6V2_BCL2L1-01       gtgtcaggcctttccagagcttctct---------------ctcccaaat
H0XR82_BCL2L2-01       -----cggagttcacagctctatacgg-------ggacggggccctggag
H0WKI0_BCL2-01         -----acgcctttgtggaattgtatg---------------gccccagca
H0WZ06_BCL2L10-01      -----atggcttttgtcagttcttca-----------ggacacccttacc
H0XFB7_MCL1-01         -----atgggtttgtggagttcttcca-------tgtagaggacctagaa
H0XHA5_MCL1-01         -----atggctttgtggagttcttcta-------cctggaagacctggaa
                              *  **                                *     

H0WZ23_BCL2A1-01       gg----ctgacttttctggaagttacaagaaagatctgtgaaatgctgcc
H0X6V2_BCL2L1-01       caaattccatttatttcaaagtttgcatgtgtg-----gcaatttttgct
H0XR82_BCL2L2-01       gaggctcggcgtctgcgggaggggaactgggcatcagtgaggacagtgct
H0WKI0_BCL2-01         tg----cggcctctgtttgacttctcctggctgtctctgaagaccctgct
H0WZ06_BCL2L10-01      gc----tagctttttggagaagattgctgttcg-------aagttttact
H0XFB7_MCL1-01         gg----cggcatc----agaaatgtgctgctggcttttgcgggtgttgct
H0XHA5_MCL1-01         ag----cagcgtc----agaaacgtgctgctggctttcgcaggtgttgct
                                  *       *        *                 * * 

H0WZ23_BCL2A1-01       tctcctg-------------------------------------------
H0X6V2_BCL2L1-01       ctt--tggctgcagc--tgggagat-gcttgactataggagtt-------
H0XR82_BCL2L2-01       gacaggggccgtggcactgggggccctggtaactgtaggggccttttt-t
H0WKI0_BCL2-01         cagcctggccctgg---tgggagcttgcatcaccctgggtgcctacct-g
H0WZ06_BCL2L10-01      gt---tgtgctttt---tagcaacggtcttca---------tctatttct
H0XFB7_MCL1-01         gg---ag----------taggagctggtttgg---------catatctaa
H0XHA5_MCL1-01         gg---ag----------taggagctggcttga---------cctatctaa
                             *                                           

H0WZ23_BCL2A1-01       ----------------
H0X6V2_BCL2L1-01       ----atgggttattct
H0XR82_BCL2L2-01       gctagcaagtga----
H0WKI0_BCL2-01         ggccacaagtga----
H0WZ06_BCL2L10-01      ggacacgacttact--
H0XFB7_MCL1-01         taagatag--------
H0XHA5_MCL1-01         taagatag--------
                                       

© 1998-2018