Dataset for CDS MCL-1 of organism Oryzias melastigma

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3CEX1_MCL1-02      atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctg
A0A3B3CEX1_MCL1-01      atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctg
                        **************************************************

A0A3B3CEX1_MCL1-02      tggatgtacggcactcttcggcggagcgggagagagatccgcgcgcgtgc
A0A3B3CEX1_MCL1-01      tggatgtacggcactcttcggcggagcgggagagagatccgcgcgcgtgc
                        **************************************************

A0A3B3CEX1_MCL1-02      ctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaa
A0A3B3CEX1_MCL1-01      ctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaa
                        **************************************************

A0A3B3CEX1_MCL1-02      cagatgaaaagaccgcaggacctcgacatgttagggaataaatctccgta
A0A3B3CEX1_MCL1-01      cagatgaaaagaccgcaggacctcgacatgttagggaataaatctccgta
                        **************************************************

A0A3B3CEX1_MCL1-02      tgcggcgaggaggtttcacgacgacgacggcggctctctcccgaacaccc
A0A3B3CEX1_MCL1-01      tgcggcgaggaggtttcacgacgacgacggcggctctctcccgaacaccc
                        **************************************************

A0A3B3CEX1_MCL1-02      cggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgata
A0A3B3CEX1_MCL1-01      cggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgata
                        **************************************************

A0A3B3CEX1_MCL1-02      aaccaggacaccacggaattcctcacgaacttctttaggaactatgttgg
A0A3B3CEX1_MCL1-01      aaccaggacaccacggaattcctcacgaacttctttaggaactatgttgg
                        **************************************************

A0A3B3CEX1_MCL1-02      attatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
A0A3B3CEX1_MCL1-01      attatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
                        **************************************************

A0A3B3CEX1_MCL1-02      gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatg
A0A3B3CEX1_MCL1-01      gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatg
                        **************************************************

A0A3B3CEX1_MCL1-02      atcaataggctgtctttggaagacaatttggacgatatgtcatttattag
A0A3B3CEX1_MCL1-01      atcaataggctgtctttggaagacaatttggacgatatgtcatttattag
                        **************************************************

A0A3B3CEX1_MCL1-02      ccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgca
A0A3B3CEX1_MCL1-01      ccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgca
                        **************************************************

A0A3B3CEX1_MCL1-02      tcgccagcctgctggccttcggggcggcggtgtgtctgcagctgaaggag
A0A3B3CEX1_MCL1-01      tcgccagcctgctggccttcggggcggcggtgtgtctgcagctgaaggag
                        **************************************************

A0A3B3CEX1_MCL1-02      aagggcagaggtcactccgtggacctggtcagtcaggagatctgcacgta
A0A3B3CEX1_MCL1-01      aagggcagaggtcactccgtggacctggtcagtcaggagatctgcacgta
                        **************************************************

A0A3B3CEX1_MCL1-02      cctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatg
A0A3B3CEX1_MCL1-01      cctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatg
                        **************************************************

A0A3B3CEX1_MCL1-02      gtttcgtagagttctttcacgtcccagacccagaatcaacagtcaggaac
A0A3B3CEX1_MCL1-01      gtttcgtagagttctttcacgtcccagacccagaatcaacagtcaggaac
                        **************************************************

A0A3B3CEX1_MCL1-02      actttggtggccgtccttggacttgcaggcgttggggctttactggccca
A0A3B3CEX1_MCL1-01      actttggtggccgtccttggacttgcaggcgttggggctttactggccca
                        **************************************************

A0A3B3CEX1_MCL1-02      ggtgtgtag-----------------------------------------
A0A3B3CEX1_MCL1-01      ggtgcaaggtccataccgtatttggcaggatatgacatcatgtcacacta
                        ****    *                                         

A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3B3CEX1_MCL1-01      atctatccaaaaataaagttggaagatcaccaagttttgctgttgaaggg
                                                                          

A0A3B3CEX1_MCL1-02      --gtga
A0A3B3CEX1_MCL1-01      ccgtaa
                          ** *

© 1998-2019