Dataset for CDS BCL2L1 of organism Oryzias melastigma

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3DHA1_BCL2L1-      atgtccc---gcaacagagaactggttgttttctacgtgaagtataaact
A0A3B3E2W4_BCL2L1-      atgtcccactgtaaccgagagctggtgcagttctatttaggctataagat
                        *******   * *** **** *****    *****  *    *****  *

A0A3B3DHA1_BCL2L1-      gtctcagaggaactaccccctcaaccacatagtgctcaatgagtctccga
A0A3B3E2W4_BCL2L1-      gtcatccagagactatcctgt----------gtccctgctgaaaccc---
                        ***    **  **** **  *          ** *    ***  * *   

A0A3B3DHA1_BCL2L1-      acaggactgctgcgggggaggtgggcgagga-------gcagagcacaga
A0A3B3E2W4_BCL2L1-      acaga--tgatgggggacaaactgcagaggaccgctctgctacctgcaac
                        ****   ** ** ***  *    *  *****       **      **  

A0A3B3DHA1_BCL2L1-      gacgcac--gccaac----gggacgtttaacgggacgagtcccgggaccc
A0A3B3E2W4_BCL2L1-      ggcacactggtcaacagcgaggacggccagctgaagaagtcctg------
                        * * ***  * ****     *****   * * * *  ***** *      

A0A3B3DHA1_BCL2L1-      cgccgctatccccgctgcgtcagcagcagttgccgtcgacgacgaacatg
A0A3B3E2W4_BCL2L1-      --------cccctgttgtgctag-----------------------catg
                                 *** * ** *  **                       ****

A0A3B3DHA1_BCL2L1-      gacgcagtgaaggaggcgctccgggacacggccaacgagttcgagctgcg
A0A3B3E2W4_BCL2L1-      gatgccatcaaatccacccttaaagattcggccaatgagtttgagcgtcg
                        ** **  * **     * **    **  ******* ***** ****  **

A0A3B3DHA1_BCL2L1-      gtacgccctggccttcaacaacctgcacagccagctgcacatcacgcccg
A0A3B3E2W4_BCL2L1-      cttcagtcaaggttttagtgatctctctctgcagtttcacatcactcctg
                         * *   *  *  ** *   * **       *** * ******** ** *

A0A3B3DHA1_BCL2L1-      ccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgac
A0A3B3E2W4_BCL2L1-      acacggcctaccaaaacttcaaaagtgtgttggatgagctgttcaaggat
                         ************ * **** * *  *** ** * *********   ** 

A0A3B3DHA1_BCL2L1-      aacatcaactgggggcgcatcgtggggctcttcgcgttcggcggggcgct
A0A3B3E2W4_BCL2L1-      gggataaactgggggcgtgttgtgggtttgtttgtctttggtggtgtgct
                           ** ***********  * *****  * ** *  ** ** ** * ***

A0A3B3DHA1_BCL2L1-      gtgcgtcgagtgcgtggagaaggagatgagccccctggtggacaggattg
A0A3B3E2W4_BCL2L1-      gtgtgttgagtgtgtcgagaggaatatgagtgagctggtctcccgcattg
                        *** ** ***** ** **** * * *****    *****   * * ****

A0A3B3DHA1_BCL2L1-      tggagtggatgaccgtctacctggacaaccacatccagccgtggatccag
A0A3B3E2W4_BCL2L1-      ctgaatggatgaccatgtacctagacgagcaaataagtccatggatccac
                          ** ********* * ***** *** * ** **    ** ******** 

A0A3B3DHA1_BCL2L1-      agccaaggcggatgggagcgttttgctgaaatctttgggcaggaggccgc
A0A3B3E2W4_BCL2L1-      agtcaaggaggatgggattgctttgcacagctgtatgggcaggatggcgc
                        ** ***** ********  * *****  *  * * ********* * ***

A0A3B3DHA1_BCL2L1-      agccgaaagcagaaggtctcaggagagcttcaagaagtggctgctggtgg
A0A3B3E2W4_BCL2L1-      tgcagaagcgagaagatttcaagagacgctgaaaaagtggacgctggtcg
                         ** ***   ***** * *** ****   * ** ******  ****** *

A0A3B3DHA1_BCL2L1-      ggatgacggtggcgaccggcgtcctggtgggatccttcatcgcccagaaa
A0A3B3E2W4_BCL2L1-      cagtggcacttctaaccggactgctgcttggtttgctcattgccaagaaa
                           ** *  *    *****  * *** * ** *   **** *** *****

A0A3B3DHA1_BCL2L1-      cgcctgtga
A0A3B3E2W4_BCL2L1-      cg---gtga
                        **   ****

© 1998-2019