Dataset for CDS MCL-1 of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2MLZ3_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacg
H2MLZ3_MCL1-02      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacg
                    ************************************************************

H2MLZ3_MCL1-01      ggacacatcctcggcagcagagcgggagagatgtccgcgcgcgtgcctctgccgtccaca
H2MLZ3_MCL1-02      ggacacatcctcggcagcagagcgggagagatgtccgcgcgcgtgcctctgccgtccaca
                    ************************************************************

H2MLZ3_MCL1-01      ttagcctctcacgtggcaaaccccgacccgtccgatcagctcaaaagaccgcaggacctc
H2MLZ3_MCL1-02      ttagcctctcacgtggcaaaccccgacccgtccgatcagctcaaaagaccgcaggacctc
                    ************************************************************

H2MLZ3_MCL1-01      gagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
H2MLZ3_MCL1-02      gagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
                    ************************************************************

H2MLZ3_MCL1-01      gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag
H2MLZ3_MCL1-02      gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag
                    ************************************************************

H2MLZ3_MCL1-01      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttctcagtatcgg
H2MLZ3_MCL1-02      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttctcagtatcgg
                    ************************************************************

H2MLZ3_MCL1-01      caccgggataataaatacatgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaa
H2MLZ3_MCL1-02      caccgggataataaatacatgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaa
                    ************************************************************

H2MLZ3_MCL1-01      cacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
H2MLZ3_MCL1-02      cacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
                    ************************************************************

H2MLZ3_MCL1-01      atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggc
H2MLZ3_MCL1-02      atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggc
                    ************************************************************

H2MLZ3_MCL1-01      cgcatcgtcagcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc
H2MLZ3_MCL1-02      cgcatcgtcagcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc
                    ************************************************************

H2MLZ3_MCL1-01      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgctgagtgagcag
H2MLZ3_MCL1-02      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgctgagtgagcag
                    ************************************************************

H2MLZ3_MCL1-01      cggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
H2MLZ3_MCL1-02      cggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
                    ************************************************************

H2MLZ3_MCL1-01      gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggg
H2MLZ3_MCL1-02      gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggg
                    ************************************************************

H2MLZ3_MCL1-01      gctttactggcccagcttagt---------------------------------------
H2MLZ3_MCL1-02      gctttactggcccagcttaatatgatggccatttttaaaggacttcctgcttctaccaga
                    ******************* *                                       

H2MLZ3_MCL1-01      ------------aggtga
H2MLZ3_MCL1-02      cttcacaactcgagatag
                                ** *  

© 1998-2019