Dataset for CDS BCL-2-like of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

18 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9MKK4_BCL2L1-      atgtcccactgtaacagagagctggtccggttctatttagcctacaagat
A0A3P9MKK4_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctacaagat
A0A3B3I2Q5_BCL2L1-      atgtcccactgtaacagagagctggtccggttctatttagcctataagat
A0A3B3I2Q5_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctataagat
A0A3P9I2N4_BCL2L1-      atgtcccactgtaacagggagctggttcggttctatttagcctataagat
A0A3P9I2N4_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctataagat
A0A3P9ILF6_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtct-aact
A0A3P9ILF6_MCL1-02      atgtttcctttgcaaaaacagatggttaacagctacatcacgtct-aact
A0A3B3IJ04_MCL1-02      atgtttcctttgcaaaaacagatggttaacagctacatcacgtct-aact
A0A3B3IJ04_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtct-aact
A0A3P9L1F3_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtct-aact
A0A3P9L1F3_MCL1-02      atgtttcctttgcaaaaacagatggttaacagctacatcacgtct-aact
A0A3P9IIZ2_BCL2L10      atgt---c---------------------------------ttgtgggct
A0A3P9LM07_BCL2L10      atgt---c---------------------------------ttgtgggct
H2MBQ3_BCL2L10-01       atgt---c---------------------------------ttgtgggct
A0A3P9J8Y9_BCL2-01      atgg---c---gaacg-------------tgtctaatcgcagtat----t
A0A3B3IB64_BCL2L1-      atgt---cccggaacagagaactggttgttttctacgtgaagtataaact
A0A3P9JYH1_BCL2L1-      atgt---cccggaacagagaactggttgttttctacgtgaagtataaact
                        ***                                       *      *

A0A3P9MKK4_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtccc
A0A3P9MKK4_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtccc
A0A3B3I2Q5_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtccc
A0A3B3I2Q5_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtccc
A0A3P9I2N4_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtccc
A0A3P9I2N4_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtccc
A0A3P9ILF6_MCL1-01      gtggatttacggga--cacatcctcg---gcagagcgggagagatgtccg
A0A3P9ILF6_MCL1-02      gtggatttacggga--cacatcctcg---gcagagcgggagagatgtccg
A0A3B3IJ04_MCL1-02      gtggatttacggga--cacatcctcggcagcagagcgggagagatgtccg
A0A3B3IJ04_MCL1-01      gtggatttacggga--cacatcctcggcagcagagcgggagagatgtccg
A0A3P9L1F3_MCL1-01      gtggatttacggga--cacatcctcggcagcagagcgggagagatgtccg
A0A3P9L1F3_MCL1-02      gtggatttacggga--cacatcctcggcagcagagcgggagagatgtccg
A0A3P9IIZ2_BCL2L10      gagga---aagaga-------ccctagctgt------------ggccct-
A0A3P9LM07_BCL2L10      gagga---aagaga-------ccctagctgt------------ggccct-
H2MBQ3_BCL2L10-01       gagga---aagaga-------ccctagctgt------------ggccct-
A0A3P9J8Y9_BCL2-01      gtaga---aaagta-------catttgccaca-----------aactctc
A0A3B3IB64_BCL2L1-      gtctc---agaggaactaccccctcaaccacatagtgctcaatgagtctc
A0A3P9JYH1_BCL2L1-      gtctc---agaggaactaccccctcaaccacatagtgctcaatgagtctc
                        *                                              *  

A0A3P9MKK4_BCL2L1-      tgctgaagccca-cag----------------------------------
A0A3P9MKK4_BCL2L1-      tgctgaagccca-cag----------------------------------
A0A3B3I2Q5_BCL2L1-      tgctgaagccca-cag----------------------------------
A0A3B3I2Q5_BCL2L1-      tgctgaagccca-cag----------------------------------
A0A3P9I2N4_BCL2L1-      tgctgaagccca-cag----------------------------------
A0A3P9I2N4_BCL2L1-      tgctgaagccca-cag----------------------------------
A0A3P9ILF6_MCL1-01      cgcgcgtgcct--ctgccgtccacattggcctctcgcgtggcaaatcccg
A0A3P9ILF6_MCL1-02      cgcgcgtgcct--ctgccgtccacattggcctctcgcgtggcaaatcccg
A0A3B3IJ04_MCL1-02      cgcgcgtgcct--ctgccgtccacattagcctctcacgtggcaaaccccg
A0A3B3IJ04_MCL1-01      cgcgcgtgcct--ctgccgtccacattagcctctcacgtggcaaaccccg
A0A3P9L1F3_MCL1-01      cgcgcgtccct--ctgccgtccacattagcctctcgcgtggcaaaccccg
A0A3P9L1F3_MCL1-02      cgcgcgtccct--ctgccgtccacattagcctctcgcgtggcaaaccccg
A0A3P9IIZ2_BCL2L10      ------ggattacctg------------------tccctga---------
A0A3P9LM07_BCL2L10      ------ggattacctg------------------tccctga---------
H2MBQ3_BCL2L10-01       ------ggattacctg------------------tccctga---------
A0A3P9J8Y9_BCL2-01      caagaggggcta-c-g------------------tgtgtgg---------
A0A3B3IB64_BCL2L1-      cgaacaggactg-ctg------------------cggggga---------
A0A3P9JYH1_BCL2L1-      cgaacaggactg-ctg------------------cggggga---------
                                     * *                                  

A0A3P9MKK4_BCL2L1-      -----------------------acgatgggggagaaactg---------
A0A3P9MKK4_BCL2L1-      -----------------------acgatgggggagaaactg---------
A0A3B3I2Q5_BCL2L1-      -----------------------acgatgggggagaaactg---------
A0A3B3I2Q5_BCL2L1-      -----------------------acgatgggggagaaactg---------
A0A3P9I2N4_BCL2L1-      -----------------------atgatgggggagaaactg---------
A0A3P9I2N4_BCL2L1-      -----------------------atgatgggggagaaactg---------
A0A3P9ILF6_MCL1-01      acccgtccgatcagttcaaaagaccgcaggacctcgagtattccgcgagg
A0A3P9ILF6_MCL1-02      acccgtccgatcagttcaaaagaccgcaggacctcgagtattccgcgagg
A0A3B3IJ04_MCL1-02      acccgtccgatcagctcaaaagaccgcaggacctcgagtattccgcgagg
A0A3B3IJ04_MCL1-01      acccgtccgatcagctcaaaagaccgcaggacctcgagtattccgcgagg
A0A3P9L1F3_MCL1-01      acccgtccgatcagctcaaaagaccgcaggacctcgagtactccgcgagg
A0A3P9L1F3_MCL1-02      acccgtccgatcagctcaaaagaccgcaggacctcgagtactccgcgagg
A0A3P9IIZ2_BCL2L10      -------------------------gctg---------cag---------
A0A3P9LM07_BCL2L10      -------------------------gctg---------cag---------
H2MBQ3_BCL2L10-01       -------------------------gctg---------cag---------
A0A3P9J8Y9_BCL2-01      -------------------------gctgaacggcggccagcgcgagaat
A0A3B3IB64_BCL2L1-      -------------------------ggtgggcgaggagcagagcacggag
A0A3P9JYH1_BCL2L1-      -------------------------ggtgggcgaggagcagagcacggag
                                                 *  *                     

A0A3P9MKK4_BCL2L1-      ---------------------aagaggaccactccgctgcccg-------
A0A3P9MKK4_BCL2L1-      ---------------------aagaggaccactccgctgcccg-------
A0A3B3I2Q5_BCL2L1-      ---------------------aagaggaccactccgatgcccg-------
A0A3B3I2Q5_BCL2L1-      ---------------------aagaggaccactccgatgcccg-------
A0A3P9I2N4_BCL2L1-      ---------------------aagaggaccactccgctgcccg-------
A0A3P9I2N4_BCL2L1-      ---------------------aagaggaccactccgctgcccg-------
A0A3P9ILF6_MCL1-01      aggtttcacgacgtcgacgacgatggctctctcccgaacaccccggagct
A0A3P9ILF6_MCL1-02      aggtttcacgacgtcgacgacgatggctctctcccgaacaccccggagct
A0A3B3IJ04_MCL1-02      aggtttcacgacgtcgacgacgatggctctctccccaacaccccggagtt
A0A3B3IJ04_MCL1-01      aggtttcacgacgtcgacgacgatggctctctccccaacaccccggagtt
A0A3P9L1F3_MCL1-01      aggtttcacgacgtcgacgacgatggctctctcccgaacacccccgagct
A0A3P9L1F3_MCL1-02      aggtttcacgacgtcgacgacgatggctctctcccgaacacccccgagct
A0A3P9IIZ2_BCL2L10      ------------------------gagcccactcca--------------
A0A3P9LM07_BCL2L10      ------------------------gagcccactcca--------------
H2MBQ3_BCL2L10-01       ------------------------gagcccactcca--------------
A0A3P9J8Y9_BCL2-01      gctgccaataacggctcggttg--gggaccattccc-cgactcc------
A0A3B3IB64_BCL2L1-      acgcacgccaacgggacgtttaacgggacaactcccgggacccc------
A0A3P9JYH1_BCL2L1-      acgcacgccaacgggacgtttaacgggacaactcccgggacccc------
                                                    *    **               

A0A3P9MKK4_BCL2L1-      ---------gaatggcaggccggtcagcag--tgaggactgc--cagctg
A0A3P9MKK4_BCL2L1-      ---------gaatggcaggccggtcagcag--tgaggactgc--cagctg
A0A3B3I2Q5_BCL2L1-      ---------gaatcgcaggctggtcagcag--tgaggacggc--cggctg
A0A3B3I2Q5_BCL2L1-      ---------gaatcgcaggctggtcagcag--tgaggacggc--cggctg
A0A3P9I2N4_BCL2L1-      ---------gaacggcaggcaggtcagcag--tgaggacggc--cagctg
A0A3P9I2N4_BCL2L1-      ---------gaacggcaggcaggtcagcag--tgaggacggc--cagctg
A0A3P9ILF6_MCL1-01      ggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaa
A0A3P9ILF6_MCL1-02      ggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaa
A0A3B3IJ04_MCL1-02      ggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaa
A0A3B3IJ04_MCL1-01      ggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaa
A0A3P9L1F3_MCL1-01      ggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaa
A0A3P9L1F3_MCL1-02      ggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaa
A0A3P9IIZ2_BCL2L10      ---------ggcccccccacctcccagcga------gtcagctgctgcca
A0A3P9LM07_BCL2L10      ---------ggcccccccacctcccagcga------gtcagctgctgcca
H2MBQ3_BCL2L10-01       ---------ggcccccccacctcccagcga------gtcagctgctgcca
A0A3P9J8Y9_BCL2-01      ---------ggtccgc---cgccgctgcgacgcaggaacggggcctgacg
A0A3B3IB64_BCL2L1-      ---------g--ccgctctccccgctgcga--gagcaacagttgccgtcg
A0A3P9JYH1_BCL2L1-      ---------c--ccgctctccccgctgcga--gagcaacagttgccgtcg
                                       *        *  *            *   *     

A0A3P9MKK4_BCL2L1-      agga----------------------------------------------
A0A3P9MKK4_BCL2L1-      agga----------------------------------------------
A0A3B3I2Q5_BCL2L1-      agga----------------------------------------------
A0A3B3I2Q5_BCL2L1-      agga----------------------------------------------
A0A3P9I2N4_BCL2L1-      agga----------------------------------------------
A0A3P9I2N4_BCL2L1-      agga----------------------------------------------
A0A3P9ILF6_MCL1-01      acgaggacaccacggaattcctcaccaatttctttaggaactttgttgga
A0A3P9ILF6_MCL1-02      acgaggacaccacggaattcctcaccaatttctttaggaactttgttgga
A0A3B3IJ04_MCL1-02      acgaggacaccacggaattcctcaccaatttctttaggaactttgttgga
A0A3B3IJ04_MCL1-01      acgaggacaccacggaattcctcaccaatttctttaggaactttgttgga
A0A3P9L1F3_MCL1-01      acgaggacaccacggaattcctcaccaatttctttaggaactttgttgga
A0A3P9L1F3_MCL1-02      acgaggacaccacggaattcctcaccaatttctttaggaactttgttgga
A0A3P9IIZ2_BCL2L10      tgag----------------------------------------------
A0A3P9LM07_BCL2L10      tgag----------------------------------------------
H2MBQ3_BCL2L10-01       tgag----------------------------------------------
A0A3P9J8Y9_BCL2-01      aggagagcagcccccgcctcatcagagcgctctcccggg-----------
A0A3B3IB64_BCL2L1-      acga---caaacatggacgcagtgaa------------------------
A0A3P9JYH1_BCL2L1-      acga---caaacatggacgcagtgaa------------------------
                                                                          

A0A3P9MKK4_BCL2L1-      --------ggtcctgtccctgttgtgctagcatggacgccatcaaatcaa
A0A3P9MKK4_BCL2L1-      --------ggtcctgtccctgttgtgctagcatggacgccatcaaatcaa
A0A3B3I2Q5_BCL2L1-      --------ggtcctgtccctgttgtgctagcatggacgccatcaaatcaa
A0A3B3I2Q5_BCL2L1-      --------ggtcctgtccctgttgtgctagcatggacgccatcaaatcaa
A0A3P9I2N4_BCL2L1-      --------ggtcctgtccctgttgtgctagcatggacgccatcaaatcaa
A0A3P9I2N4_BCL2L1-      --------ggtcctgtccctgttgtgctagcatggacgccatcaaatcaa
A0A3P9ILF6_MCL1-01      atttctcagtatccacaccgggataataaata-------catgtcgaccg
A0A3P9ILF6_MCL1-02      atttctcagtatccacaccgggataataaata-------catgtcgaccg
A0A3B3IJ04_MCL1-02      atttctcagtatcggcaccgggataataaata-------catgtcgaccg
A0A3B3IJ04_MCL1-01      atttctcagtatcggcaccgggataataaata-------catgtcgaccg
A0A3P9L1F3_MCL1-01      atttctcagtatcggcaccgggataataaata-------catgtcgaccg
A0A3P9L1F3_MCL1-02      atttctcagtatcggcaccgggataataaata-------catgtcgaccg
A0A3P9IIZ2_BCL2L10      --------gcgcctggcccagg---------a-------ca---------
A0A3P9LM07_BCL2L10      --------gcgcctggcccagg---------a-------ca---------
H2MBQ3_BCL2L10-01       --------gcgcctggcccagg---------a-------ca---------
A0A3P9J8Y9_BCL2-01      -------cggacccgctcgcgg---------a-------catccacaggg
A0A3B3IB64_BCL2L1-      --------ggaggcgctccggg---------a-------ca---------
A0A3P9JYH1_BCL2L1-      --------ggaggcgctccggg---------a-------ca---------
                                *        *  *          *       **         

A0A3P9MKK4_BCL2L1-      ctctcaaagattcggccgatgagtttgaa-----------------cgtc
A0A3P9MKK4_BCL2L1-      ctctcaaagattcggccgatgagtttgaa-----------------cgtc
A0A3B3I2Q5_BCL2L1-      ctctcaaagattcggccgatgagtttgaa-----------------cgtc
A0A3B3I2Q5_BCL2L1-      ctctcaaagattcggccgatgagtttgaa-----------------cgtc
A0A3P9I2N4_BCL2L1-      ctctcaaagattcggccgatgagtttgaa-----------------cgtc
A0A3P9I2N4_BCL2L1-      ctctcaaagattcggccgatgagtttgaa-----------------cgtc
A0A3P9ILF6_MCL1-01      cgaaaagagtggtgaacgacgtgttagagaaacacaagattacttacaac
A0A3P9ILF6_MCL1-02      cgaaaagagtggtgaacgacgtgttagagaaacacaagattacttacaac
A0A3B3IJ04_MCL1-02      cgaaaagagtggtgaacgacgtgttagagaaacacaagattacttacaac
A0A3B3IJ04_MCL1-01      cgaaaagagtggtgaacgacgtgttagagaaacacaagattacttacaac
A0A3P9L1F3_MCL1-01      cgaaaagagtggtgaacgacgtgttagagaaacacaagattacttacaac
A0A3P9L1F3_MCL1-02      cgaaaagagtggtgaacgacgtgttagagaaacacaagattacttacaac
A0A3P9IIZ2_BCL2L10      ------------tggaggcgcagtaccag-----------------cccc
A0A3P9LM07_BCL2L10      ------------tggaggcgcagtaccag-----------------cccc
H2MBQ3_BCL2L10-01       ------------tggaggcgcagtaccag-----------------cccc
A0A3P9J8Y9_BCL2-01      tcctgcgcgaggcgggagacgagctggag-----------------cggc
A0A3B3IB64_BCL2L1-      ------------cggccaacgagttcgag-----------------ctcc
A0A3P9JYH1_BCL2L1-      ------------cggccaacgagttcgag-----------------ctcc
                                     *        *    *                  *  *

A0A3P9MKK4_BCL2L1-      gtttc---------catcaaggttttagtgatctctccgtgcagcttcat
A0A3P9MKK4_BCL2L1-      gtttc---------catcaaggttttagtgatctctccgtgcagcttcat
A0A3B3I2Q5_BCL2L1-      gtttc---------catcaaggttttagtgatctctccgtgcagcttcat
A0A3B3I2Q5_BCL2L1-      gtttc---------catcaaggttttagtgatctctccgtgcagcttcat
A0A3P9I2N4_BCL2L1-      gtttc---------catcaaggttttagtgatctctccgtgcagcttcat
A0A3P9I2N4_BCL2L1-      gtttc---------catcaaggttttagtgatctctccgtgcagcttcat
A0A3P9ILF6_MCL1-01      ggtat-------gatcgtcagactgtcgttggacgaccagggggatg-at
A0A3P9ILF6_MCL1-02      ggtat-------gatcgtcagactgtcgttggacgaccagggggatg-at
A0A3B3IJ04_MCL1-02      ggtat-------gatcgtcagactgtcgttggacgaccagggggatg-at
A0A3B3IJ04_MCL1-01      ggtat-------gatcgtcagactgtcgttggacgaccagggggatg-at
A0A3P9L1F3_MCL1-01      ggtat-------gatcgtcagactgtcgttggacgaccagggggatg-at
A0A3P9L1F3_MCL1-02      ggtat-------gatcgtcagactgtcgttggacgaccagggggatg-at
A0A3P9IIZ2_BCL2L10      gcttctccaccttagcacagaacttcaggaa---gcacagcgggcaggac
A0A3P9LM07_BCL2L10      gcttctccaccttagcacagaacttcaggaa---gcacagcgggccggac
H2MBQ3_BCL2L10-01       gcttctccaccttagcacagaacttcaggaa---gcacagcgggccggac
A0A3P9J8Y9_BCL2-01      tgtac---------cagcgggacttcacggagatgtcgcggcagctgtac
A0A3B3IB64_BCL2L1-      ggtac---------gcccttgccttcaacaacctgcacagccagctgcac
A0A3P9JYH1_BCL2L1-      ggtac---------gccctggccttcaacaacctgcacagccagctgcac
                          *                    *                   *    * 

A0A3P9MKK4_BCL2L1-      atcactccggacacggcctaccaaaacttcaaaagggtgttggatgagct
A0A3P9MKK4_BCL2L1-      atcactccggacacggcctaccaaaacttcaaaagggtgttggatgagct
A0A3B3I2Q5_BCL2L1-      atcactccagacacggcctaccaaaacttcaaaagggtgttggatgagct
A0A3B3I2Q5_BCL2L1-      atcactccagacacggcctaccaaaacttcaaaagggtgttggatgagct
A0A3P9I2N4_BCL2L1-      atcactccggacacggcctaccaaaacttcaaaagggtgttggatgagct
A0A3P9I2N4_BCL2L1-      atcactccggacacggcctaccaaaacttcaaaagggtgttggatgagct
A0A3P9ILF6_MCL1-01      atgtcatttg------------------tcagcagcgtagcgaagagcct
A0A3P9ILF6_MCL1-02      atgtcatttg------------------tcagcagcgtagcgaagagcct
A0A3B3IJ04_MCL1-02      atgtcatttg------------------tcagcagcgtagcgaagagcct
A0A3B3IJ04_MCL1-01      atgtcatttg------------------tcagcagcgtagcgaagagcct
A0A3P9L1F3_MCL1-01      atgtcatttg------------------tcagcagcgtagcgaagagcct
A0A3P9L1F3_MCL1-02      atgtcatttg------------------tcagcagcgtagcgaagagcct
A0A3P9IIZ2_BCL2L10      ctgtgctcc---------------agcctcaggaaggtgatggaggagct
A0A3P9LM07_BCL2L10      ctgtgctcc---------------agcctcaggaaggtgatggaggagct
H2MBQ3_BCL2L10-01       ctgtgctcc---------------agcctcaggaaggtgatggaggagct
A0A3P9J8Y9_BCL2-01      ctcacctccaccacggcgaagacgaggttcgccgaggtgattgacgaact
A0A3B3IB64_BCL2L1-      atcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagct
A0A3P9JYH1_BCL2L1-      atcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagct
                         *                          **      **     *    **

A0A3P9MKK4_BCL2L1-      gttcaaggatg---ggatcaactgggggcgcgttgtgggtttatttgtct
A0A3P9MKK4_BCL2L1-      gttcaaggatg---ggatcaactgggggcgcgttgtgggtttatttgtct
A0A3B3I2Q5_BCL2L1-      gttcaaggatg---ggatcaactgggggcgcgttgtgggtttgtttgtct
A0A3B3I2Q5_BCL2L1-      gttcaaggatg---ggatcaactgggggcgcgttgtgggtttgtttgtct
A0A3P9I2N4_BCL2L1-      gttcaaggatg---ggatcaactgggggcgcgttgtgggtttgtttgtct
A0A3P9I2N4_BCL2L1-      gttcaaggatg---ggatcaactgggggcgcgttgtgggtttgtttgtct
A0A3P9ILF6_MCL1-01      ttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcct
A0A3P9ILF6_MCL1-02      ttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcct
A0A3B3IJ04_MCL1-02      ttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcct
A0A3B3IJ04_MCL1-01      ttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcct
A0A3P9L1F3_MCL1-01      ttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcct
A0A3P9L1F3_MCL1-02      ttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcct
A0A3P9IIZ2_BCL2L10      ggtgggagatgaacgcttgaactgggggagggtcgtttccctttttgcat
A0A3P9LM07_BCL2L10      ggtgggagatgaacgcttgaactgggggagggtcgtttccctttttgcat
H2MBQ3_BCL2L10-01       ggtgggagatgaacgcttgaactgggggagggtcgtttccctttttgcat
A0A3P9J8Y9_BCL2-01      gttccgggacg---gcgtgaactggggccggattatcgcgttcttcgagt
A0A3B3IB64_BCL2L1-      gttccgcgaca---acatcaactggggccgcatcgtggggctcttcgcat
A0A3P9JYH1_BCL2L1-      gttccgcgaca---acatcaactggggccgcatcgtggggctcttcgcat
                          *    **          ********  *  *  *     *  * *  *

A0A3P9MKK4_BCL2L1-      ttggtggtgcgctgtgtgtc------gagtgtg---tagagaggaatatg
A0A3P9MKK4_BCL2L1-      ttggtggtgcgctgtgtgtc------gagtgtg---tagagaggaatatg
A0A3B3I2Q5_BCL2L1-      ttggtggtgcgctgtgtgtc------gagtgtg---tcgagaggaatatg
A0A3B3I2Q5_BCL2L1-      ttggtggtgcgctgtgtgtc------gagtgtg---tcgagaggaatatg
A0A3P9I2N4_BCL2L1-      ttggtggtgcgctgtgtgtc------gagtgtg---tagagaggaatatg
A0A3P9I2N4_BCL2L1-      ttggtggtgcgctgtgtgtc------gagtgtg---tagagaggaatatg
A0A3P9ILF6_MCL1-01      tcggggcggcggtgtgtcagtccttgaagg---------aaaagggcaga
A0A3P9ILF6_MCL1-02      tcggggcggcggtgtgtcagtccttgaagg---------aaaagggcaga
A0A3B3IJ04_MCL1-02      tcggggcggcggtgtgtcagtccttgaagg---------aaaagggcaga
A0A3B3IJ04_MCL1-01      tcggggcggcggtgtgtcagtccttgaagg---------aaaagggcaga
A0A3P9L1F3_MCL1-01      tcggggcggcggtgtgtcagtccttgaagg---------aaaagggcaga
A0A3P9L1F3_MCL1-02      tcggggcggcggtgtgtcagtccttgaagg---------aaaagggcaga
A0A3P9IIZ2_BCL2L10      tcgtgggagtgctg-gcgaggcagctgagggagc-----aaacagacatg
A0A3P9LM07_BCL2L10      tcgtgggagtgctg-gcgaggcagctgagggagc-----aaacagacatg
H2MBQ3_BCL2L10-01       tcgtgggagtgctg-gcgaggcagctgagggagc-----aaacagacatg
A0A3P9J8Y9_BCL2-01      tcgggggcacggtgtgcgtg------gagtgcgcgtccaacgaggagatg
A0A3B3IB64_BCL2L1-      tcggcggggcgctgtgcgtg------gagtgcg---ttgagaaggagatg
A0A3P9JYH1_BCL2L1-      tcggcggggcgctgtgcgtg------gagtgcg---ttgagaaggagatg
                        * *  *    * ** *           **          *       *  

A0A3P9MKK4_BCL2L1-      ggtgagctggtct-cccgcattgctgaatgg-------------------
A0A3P9MKK4_BCL2L1-      ggtgagctggtct-cccgcattgctgaatgg-------------------
A0A3B3I2Q5_BCL2L1-      ggtgagctggtct-cccgcattgctgaatgg-------------------
A0A3B3I2Q5_BCL2L1-      ggtgagctggtct-cccgcattgctgaatgg-------------------
A0A3P9I2N4_BCL2L1-      ggtgagctggtct-cccgcattgctgaatgg-------------------
A0A3P9I2N4_BCL2L1-      ggtgagctggtct-cccgcattgctgaatgg-------------------
A0A3P9ILF6_MCL1-01      ggtcactgcgtgg-acctggtcagtcaggag-------------------
A0A3P9ILF6_MCL1-02      ggtcactgcgtgg-acctggtcagtcaggag-------------------
A0A3B3IJ04_MCL1-02      ggtcactgcgtgg-acctggtcagtcaggag-------------------
A0A3B3IJ04_MCL1-01      ggtcactgcgtgg-acctggtcagtcaggag-------------------
A0A3P9L1F3_MCL1-01      ggtcactgcgtgg-acctggtcagtcaggag-------------------
A0A3P9L1F3_MCL1-02      ggtcactgcgtgg-acctggtcagtcaggag-------------------
A0A3P9IIZ2_BCL2L10      aacccggggctggaccccgggcgggaagtggcggccgggcctgtgagctg
A0A3P9LM07_BCL2L10      aacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagctg
H2MBQ3_BCL2L10-01       aacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagctg
A0A3P9J8Y9_BCL2-01      agcacgcaggtgg-ccagcatcgccgagtgg-------------------
A0A3B3IB64_BCL2L1-      agccccctggtgg-accggattgtggagtgg-------------------
A0A3P9JYH1_BCL2L1-      agccccctggtgg-accggattgtggagtgg-------------------
                                  *    *          *   *                   

A0A3P9MKK4_BCL2L1-      -------------------atgacccagtacctggatgagcaaataagtc
A0A3P9MKK4_BCL2L1-      -------------------atgacccagtacctggatgagcaaataagtc
A0A3B3I2Q5_BCL2L1-      -------------------atgacccagtacctggatgagcaaataagtc
A0A3B3I2Q5_BCL2L1-      -------------------atgacccagtacctggatgagcaaataagtc
A0A3P9I2N4_BCL2L1-      -------------------atgacccagtacctggatgagcaaataagtc
A0A3P9I2N4_BCL2L1-      -------------------atgacccagtacctggatgagcaaataagtc
A0A3P9ILF6_MCL1-01      -------------------atctgcacgtacctgctgagtgagcagcgga
A0A3P9ILF6_MCL1-02      -------------------atctgcacgtacctgctgagtgagcagcgga
A0A3B3IJ04_MCL1-02      -------------------atctgcacgtacctgctgagtgagcagcgga
A0A3B3IJ04_MCL1-01      -------------------atctgcacgtacctgctgagtgagcagcgga
A0A3P9L1F3_MCL1-01      -------------------atctgcacgtacctgctgagtgagcagcgga
A0A3P9L1F3_MCL1-02      -------------------atctgcacgtacctgctgagtgagcagcgga
A0A3P9IIZ2_BCL2L10      ccaggcgctggcagaaactgtagctgatttcctgggaggagacaagaaag
A0A3P9LM07_BCL2L10      ccaggcgctggcagaaactgtagctgatttcctgggaggagacaagaaag
H2MBQ3_BCL2L10-01       ccaggcgctggcagaaactgtagctgatttcctgggaggagacaagaaag
A0A3P9J8Y9_BCL2-01      -------------------atgacggagtatttaaacggacctctcaaca
A0A3B3IB64_BCL2L1-      -------------------atgaccgtctacctggacaaccacatccagc
A0A3P9JYH1_BCL2L1-      -------------------atgaccgtctacctggacaaccacatccagc
                                            *       *   *                 

A0A3P9MKK4_BCL2L1-      catggatccacagtcatggaggatgggattgctttgcacggctgtatg--
A0A3P9MKK4_BCL2L1-      catggatccacagtcatggaggatgggattgctttgcacggctgtatg--
A0A3B3I2Q5_BCL2L1-      catggatccacagtcatggaggatgggattgctttgcacggctgtatg--
A0A3B3I2Q5_BCL2L1-      catggatccacagtcatggaggatgggattgctttgcacggctgtatg--
A0A3P9I2N4_BCL2L1-      catggatccacagtcatggaggatgggattgctttgcacggctgtatg--
A0A3P9I2N4_BCL2L1-      catggatccacagtcatggaggatgggattgctttgcacggctgtatg--
A0A3P9ILF6_MCL1-01      actggctggtcaacaacaactcctgggatggtttcgtagagttctttc--
A0A3P9ILF6_MCL1-02      actggctggtcaacaacaactcctgggatggtttcgtagagttctttc--
A0A3B3IJ04_MCL1-02      actggctggtcaacaacaactcctgggatggtttcgtagagttctttc--
A0A3B3IJ04_MCL1-01      actggctggtcaacaacaactcctgggatggtttcgtagagttctttc--
A0A3P9L1F3_MCL1-01      actggctggtcaacaacaactcctgggatggtttcgtagagttctttc--
A0A3P9L1F3_MCL1-02      actggctggtcaacaacaactcctgggatggtttcgtagagttctttc--
A0A3P9IIZ2_BCL2L10      agtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
A0A3P9LM07_BCL2L10      agtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
H2MBQ3_BCL2L10-01       aatggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
A0A3P9J8Y9_BCL2-01      gctggattgaagaaaacgggggatgggatgcctttgtggagctgtacgac
A0A3B3IB64_BCL2L1-      cctggatccagagccaaggcggatgggagcgttttgctgaaatctttg--
A0A3P9JYH1_BCL2L1-      cctggatccagagccaaggcggatgggagcgttttgctgaaatctttg--
                          *** *        *       *****    **        * *     

A0A3P9MKK4_BCL2L1-      ----gccagaacggcg-ctgcagaagcgaggagatttcaagagacgctg-
A0A3P9MKK4_BCL2L1-      ----gccagaacggcg-ctgcagaagcgaggagatttcaagagacgctg-
A0A3B3I2Q5_BCL2L1-      ----gccagaacggcg-ctgcagaagcgaggagatttcaagagacgctg-
A0A3B3I2Q5_BCL2L1-      ----gccagaacggcg-ctgcagaagcgaggagatttcaagagacgctg-
A0A3P9I2N4_BCL2L1-      ----gccagaacggcg-ccgcagaagcaaggagatttcaagagacgctg-
A0A3P9I2N4_BCL2L1-      ----gccagaacggcg-ccgcagaagcaaggagatttcaagagacgctg-
A0A3P9ILF6_MCL1-01      -------------gcgtttcagacccagaaactacagtcaggaacactt-
A0A3P9ILF6_MCL1-02      -------------gcgtttcagacccagaaactacagtcaggaacactt-
A0A3B3IJ04_MCL1-02      -------------gcgtttcagacccagaaacgacagtcaggaacactt-
A0A3B3IJ04_MCL1-01      -------------gcgtttcagacccagaaacgacagtcaggaacactt-
A0A3P9L1F3_MCL1-01      -------------gcgtttcagacccagaatctacagtcaggaacactt-
A0A3P9L1F3_MCL1-02      -------------gcgtttcagacccagaatctacagtcaggaacactt-
A0A3P9IIZ2_BCL2L10      aca-gccagagaggtg-----agtcaggact---cgtccatgaagactg-
A0A3P9LM07_BCL2L10      aca-gccagagaggtg-----agtcaggact---cgtccatgaagactg-
H2MBQ3_BCL2L10-01       aca-gccagagaggtg-----agtcaggact---cgtccatgaagactg-
A0A3P9J8Y9_BCL2-01      agacagaaggaaaccgtcttcagctgctactggccgtccatcaagactgt
A0A3B3IB64_BCL2L1-      ----ggcaggaagccg----cggctgagagcagaaggtc-tcaggagag-
A0A3P9JYH1_BCL2L1-      ----ggcaggaagccg----cggctgagagcagaaggtc-tcaggagag-
                                       *            *                     

A0A3P9MKK4_BCL2L1-      ----aagaagtggatgctggtcacagtggcccttttaactggact---gc
A0A3P9MKK4_BCL2L1-      ----aagaagtggatgctggtcacagtggcccttttaactggact---gc
A0A3B3I2Q5_BCL2L1-      ----aagaagtggatgctggtcacagtggcccttttaactggact---gc
A0A3B3I2Q5_BCL2L1-      ----aagaagtggatgctggtcacagtggcccttttaactggact---gc
A0A3P9I2N4_BCL2L1-      ----aagaagtggatgctggtcacagtggcccttttaactggact---gc
A0A3P9I2N4_BCL2L1-      ----aagaagtggatgctggtcacagtggcccttttaactggact---gc
A0A3P9ILF6_MCL1-01      -------tggtggccttccttgg----------aattgctggcgt-----
A0A3P9ILF6_MCL1-02      -------tggtggccttccttgg----------aattgctggcgt-----
A0A3B3IJ04_MCL1-02      -------tggtggccttccttgg----------aattgctggcgt-----
A0A3B3IJ04_MCL1-01      -------tggtggccttccttgg----------aattgctggcgt-----
A0A3P9L1F3_MCL1-01      -------tggtggccttccttgg----------aattgctggcgt-----
A0A3P9L1F3_MCL1-02      -------tggtggccttccttgg----------aattgctggcgt-----
A0A3P9IIZ2_BCL2L10      --------------cgctcttcg---------cggcggccagcgtcggcc
A0A3P9LM07_BCL2L10      --------------cgctcttcg---------cggcggccagcgtgggcc
H2MBQ3_BCL2L10-01       --------------cgctcttcg---------cggcggccagcgtgggcc
A0A3P9J8Y9_BCL2-01      cttc--ggcctggctgctctcgg----------ggcggcgagcct---ga
A0A3B3IB64_BCL2L1-      cttcaagaagtggctgctggtggggatgacggtggcgaccggcgt---cc
A0A3P9JYH1_BCL2L1-      cttcaagaagtggctgctggtggggatgacggtggcgaccggcgt---cc
                                                              *  *  *     

A0A3P9MKK4_BCL2L1-      tgcttggtgtgctcatcaccaagaaacg----------------------
A0A3P9MKK4_BCL2L1-      tgcttggtgtgctcatcaccaagaaacg----------------------
A0A3B3I2Q5_BCL2L1-      tgctgggtgtgctcatcaccaagaaacg----------------------
A0A3B3I2Q5_BCL2L1-      tgctgggtgtgctcatcaccaagaaacg----------------------
A0A3P9I2N4_BCL2L1-      tgctgggtgtgctcatcaccaagaaacg----------------------
A0A3P9I2N4_BCL2L1-      tgctgggtgtgctcatcaccaagaaacg----------------------
A0A3P9ILF6_MCL1-01      ----tggggctttactggcccagcttagt---------------------
A0A3P9ILF6_MCL1-02      ----tggggctttactggcccagcttaatatgatggccatttttaaagga
A0A3B3IJ04_MCL1-02      ----tggggctttactggcccagcttaatatgatggccatttttaaagga
A0A3B3IJ04_MCL1-01      ----tggggctttactggcccagcttagt---------------------
A0A3P9L1F3_MCL1-01      ----tggggctttactggcccagcttagt---------------------
A0A3P9L1F3_MCL1-02      ----tggggctttactggcccagcttaatatgatggccatttttaaagga
A0A3P9IIZ2_BCL2L10      tggctggactcaccttcctcctggtgcgc---------------------
A0A3P9LM07_BCL2L10      tggctggactcaccttcctcctggtgcgc---------------------
H2MBQ3_BCL2L10-01       tggctggactcaccttcctcctggtgcgc---------------------
A0A3P9J8Y9_BCL2-01      ccattggagcataccttgcacaaaa-------------------------
A0A3B3IB64_BCL2L1-      tggtgggatccttcctcgcccagaaacgc---------------------
A0A3P9JYH1_BCL2L1-      tggtgggatccttcctcgcccagaaacgc---------------------
                             **        *                                  

A0A3P9MKK4_BCL2L1-      --------------------------------gtga
A0A3P9MKK4_BCL2L1-      --------------------------------gtga
A0A3B3I2Q5_BCL2L1-      --------------------------------gtga
A0A3B3I2Q5_BCL2L1-      --------------------------------gtga
A0A3P9I2N4_BCL2L1-      --------------------------------gtga
A0A3P9I2N4_BCL2L1-      --------------------------------gtga
A0A3P9ILF6_MCL1-01      ------------------------------aggtga
A0A3P9ILF6_MCL1-02      cttcctgcttctgccagacttcacaactcgagatag
A0A3B3IJ04_MCL1-02      cttcctgcttctaccagacttcacaactcgagatag
A0A3B3IJ04_MCL1-01      ------------------------------aggtga
A0A3P9L1F3_MCL1-01      ------------------------------aggtga
A0A3P9L1F3_MCL1-02      cttcctgcttctgccagacttcacaactggagatag
A0A3P9IIZ2_BCL2L10      ------------------------------tag---
A0A3P9LM07_BCL2L10      ------------------------------tag---
H2MBQ3_BCL2L10-01       ------------------------------tag---
A0A3P9J8Y9_BCL2-01      --------------------------------gtga
A0A3B3IB64_BCL2L1-      ------------------------------ctgtga
A0A3P9JYH1_BCL2L1-      ------------------------------ctgtga
                                                            

© 1998-2019