Dataset for CDS BCL-2-like of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3ICL7_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctataagat
A0A3B3ICL7_BCL2L1-      atgtcccactgtaacagagagctggtccggttctatttagcctataagat
H2MLZ3_MCL1-01          atgtttcctttgcaaaaacagatggttaacagctacatcacg-------t
H2MLZ3_MCL1-02          atgtttcctttgcaaaaacagatggttaacagctacatcacg-------t
A0A3B3IB64_BCL2L1-      atgt---cccggaacagagaactggttgttttctacgtgaagtataaact
A0A3P9JYH1_BCL2L1-      atgt---cccggaacagagaactggttgttttctacgtgaagtataaact
A0A3P9LM07_BCL2L10      atgt---c-----------------ttgtgggctgaggaaag---agacc
H2MBQ3_BCL2L10-01       atgt---c-----------------ttgtgggctgaggaaag---agacc

A0A3B3ICL7_BCL2L1-      gtcatgcagggacta---------tcct-------------------gtg
A0A3B3ICL7_BCL2L1-      gtcatgcagggacta---------tcct-------------------gtg
H2MLZ3_MCL1-01          ctaactgtggatttacgggacacatcctcggcagcagagcgggagagatg
H2MLZ3_MCL1-02          ctaactgtggatttacgggacacatcctcggcagcagagcgggagagatg
A0A3B3IB64_BCL2L1-      gtctcagaggaact-------accccctcaaccacatagtgctcaatgag
A0A3P9JYH1_BCL2L1-      gtctcagaggaact-------accccctcaaccacatagtgctcaatgag
A0A3P9LM07_BCL2L10      ctagctgtgg--------------ccctggattacct------------g
H2MBQ3_BCL2L10-01       ctagctgtgg--------------ccctggattacct------------g
                         *      **               ***                     *

A0A3B3ICL7_BCL2L1-      tccctgctgaagcccacagacgatgg--------gggagaaactgaagag
A0A3B3ICL7_BCL2L1-      tccctgctgaagcccacagacgatgg--------gggagaaactgaagag
H2MLZ3_MCL1-01          tccgcgcgcgtgcct-ctgccgtccac-------attagcctctcacgtg
H2MLZ3_MCL1-02          tccgcgcgcgtgcct-ctgccgtccac-------attagcctctcacgtg
A0A3B3IB64_BCL2L1-      tctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacgga
A0A3P9JYH1_BCL2L1-      tctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacgga
A0A3P9LM07_BCL2L10      tccctga--------gctgc--------------aggagc----------
H2MBQ3_BCL2L10-01       tccctga--------gctgc--------------aggagc----------
                        **   *          * *                  **           

A0A3B3ICL7_BCL2L1-      gaccactc---------------------cgatgcccggaatcgca----
A0A3B3ICL7_BCL2L1-      gaccactc---------------------cgatgcccggaatcgca----
H2MLZ3_MCL1-01          gcaaaccccgacccgtccgatcagctcaaaagaccgcaggacctcgagta
H2MLZ3_MCL1-02          gcaaaccccgacccgtccgatcagctcaaaagaccgcaggacctcgagta
A0A3B3IB64_BCL2L1-      gacgcacgccaacgggacgtttaacgggacaactcccgggaccccg----
A0A3P9JYH1_BCL2L1-      gacgcacgccaacgggacgtttaacgggacaactcccgggaccccg----
A0A3P9LM07_BCL2L10      -----------------------------ccactccaggcccccc-----
H2MBQ3_BCL2L10-01       -----------------------------ccactccaggcccccc-----
                                                          *   *   * *     

A0A3B3ICL7_BCL2L1-      -------------------------------ggctggtcagc--------
A0A3B3ICL7_BCL2L1-      -------------------------------ggctggtcagc--------
H2MLZ3_MCL1-01          ttccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaaca
H2MLZ3_MCL1-02          ttccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaaca
A0A3B3IB64_BCL2L1-      ---------------------------------ccgctctccccgc----
A0A3P9JYH1_BCL2L1-      ---------------------------------ccgctctccccgc----
A0A3P9LM07_BCL2L10      --------------------------------------cacctccc----
H2MBQ3_BCL2L10-01       --------------------------------------cacctccc----

A0A3B3ICL7_BCL2L1-      --------------agtgaggacggccggctgaggaggtcctgtccctgt
A0A3B3ICL7_BCL2L1-      --------------agtgaggacggccggctgaggaggtcctgtccctgt
H2MLZ3_MCL1-01          ccccggagttggagtgcgaggccagc----------gtttccggcgaca-
H2MLZ3_MCL1-02          ccccggagttggagtgcgaggccagc----------gtttccggcgaca-
A0A3B3IB64_BCL2L1-      --------------tgcgagagcaac---------agttgccgtcgacg-
A0A3P9JYH1_BCL2L1-      --------------tgcgagagcaac---------agttgccgtcgacg-
A0A3P9LM07_BCL2L10      --------------agcgag----tc---------agctgctgcc-----
H2MBQ3_BCL2L10-01       --------------agcgag----tc---------agctgctgcc-----
                                       * ***     *          * * * * *     

A0A3B3ICL7_BCL2L1-      tgtgctagcatggacgccatcaa----------------------atcaa
A0A3B3ICL7_BCL2L1-      tgtgctagcatggacgccatcaa----------------------atcaa
H2MLZ3_MCL1-01          -actcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaa
H2MLZ3_MCL1-02          -actcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaa
A0A3B3IB64_BCL2L1-      -a--caaacatggacgcagtgaaggagg----------------cgc---
A0A3P9JYH1_BCL2L1-      -a--caaacatggacgcagtgaaggagg----------------cgc---
A0A3P9LM07_BCL2L10      ----------------------atgagg----------------cgcctg
H2MBQ3_BCL2L10-01       ----------------------atgagg----------------cgcctg

A0A3B3ICL7_BCL2L1-      ctct--caaagattcggccg------atgagtttgaacgtcgt-----tt
A0A3B3ICL7_BCL2L1-      ctct--caaagattcggccg------atgagtttgaacgtcgt-----tt
H2MLZ3_MCL1-01          tttctttaggaactttgttggaatttctcagtatcggcaccgggataata
H2MLZ3_MCL1-02          tttctttaggaactttgttggaatttctcagtatcggcaccgggataata
A0A3B3IB64_BCL2L1-      -tcc----gggacacggcca------acgagttcgagctccgg-----ta
A0A3P9JYH1_BCL2L1-      -tcc----gggacacggcca------acgagttcgagctccgg-----ta
A0A3P9LM07_BCL2L10      gccc----aggacatggagg------cgcagtaccagccccgc-----tt
H2MBQ3_BCL2L10-01       gccc----aggacatggagg------cgcagtaccagccccgc-----tt
                                   *    *            ***     *  **      * 

A0A3B3ICL7_BCL2L1-      ccatcaaggttttagtgatctct---------------------------
A0A3B3ICL7_BCL2L1-      ccatcaaggttttagtgatctct---------------------------
H2MLZ3_MCL1-01          aatacatgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacac
H2MLZ3_MCL1-02          aatacatgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacac
A0A3B3IB64_BCL2L1-      cgcccttgccttcaacaacctgc---------------------------
A0A3P9JYH1_BCL2L1-      cgcccttgccttcaacaacctgc---------------------------
A0A3P9LM07_BCL2L10      ctcc----accttagca--caga---------------------------
H2MBQ3_BCL2L10-01       ctcc----accttagca--caga---------------------------

A0A3B3ICL7_BCL2L1-      ----------ccgtgcagcttcatatcactccagacacggcctaccaaaa
A0A3B3ICL7_BCL2L1-      ----------ccgtgcagcttcatatcactccagacacggcctaccaaaa
H2MLZ3_MCL1-01          aagattacttacaacggtatgatcgtcagactgtcgttggacgaccaggg
H2MLZ3_MCL1-02          aagattacttacaacggtatgatcgtcagactgtcgttggacgaccaggg
A0A3B3IB64_BCL2L1-      ----------acagccagctgcacatcacgcccgccacggcctaccagag
A0A3P9JYH1_BCL2L1-      ----------acagccagctgcacatcacgcccgccacggcctaccagag
A0A3P9LM07_BCL2L10      ----------acttcaggaagcacagcgggccggacctgtgctcc---ag
H2MBQ3_BCL2L10-01       ----------acttcaggaagcacagcgggccggacctgtgctcc---ag
                                   *              *   *       *  *  *     

A0A3B3ICL7_BCL2L1-      ---------------cttcaaaagggtgttggatgagctgttcaaggatg
A0A3B3ICL7_BCL2L1-      ---------------cttcaaaagggtgttggatgagctgttcaaggatg
H2MLZ3_MCL1-01          ggatgatatgtcatttgtcagcagcgtagcgaagagcctttttgcggatg
H2MLZ3_MCL1-02          ggatgatatgtcatttgtcagcagcgtagcgaagagcctttttgcggatg
A0A3B3IB64_BCL2L1-      ---------------cttcgagaacgtgatgaacgagctgttccgcgaca
A0A3P9JYH1_BCL2L1-      ---------------cttcgagaacgtgatgaacgagctgttccgcgaca
A0A3P9LM07_BCL2L10      ---------------cctcaggaaggtgatggaggagctggtgggagatg
H2MBQ3_BCL2L10-01       ---------------cctcaggaaggtgatggaggagctggtgggagatg
                                         **   *  **   * *    **  *    **  

A0A3B3ICL7_BCL2L1-      g---gatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcg
A0A3B3ICL7_BCL2L1-      g---gatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcg
H2MLZ3_MCL1-01          ggaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcg
H2MLZ3_MCL1-02          ggaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcg
A0A3B3IB64_BCL2L1-      a---catcaactggggccgcatcgtggggctcttcgcattcggcggggcg
A0A3P9JYH1_BCL2L1-      a---catcaactggggccgcatcgtggggctcttcgcattcggcggggcg
A0A3P9LM07_BCL2L10      aacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtg
H2MBQ3_BCL2L10-01       aacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtg
                                ********  *  * **     *  * *  ** *  *  * *

A0A3B3ICL7_BCL2L1-      ctgtgtgtcgagtgtgtcgag-------aggaatatgggtgagctggtct
A0A3B3ICL7_BCL2L1-      ctgtgtgtcgagtgtgtcgag-------aggaatatgggtgagctggtct
H2MLZ3_MCL1-01          ----gtgtgtcagtccttgaaggaa---aagggcagaggtcactgcgtgg
H2MLZ3_MCL1-02          ----gtgtgtcagtccttgaaggaa---aagggcagaggtcactgcgtgg
A0A3B3IB64_BCL2L1-      ctgtgcgtggagtgcgttgag-------aaggagatgagccccctggtgg
A0A3P9JYH1_BCL2L1-      ctgtgcgtggagtgcgttgag-------aaggagatgagccccctggtgg
A0A3P9LM07_BCL2L10      ctg-gcgaggca---gctgagggagcaaacagacatgaacccggggctgg
H2MBQ3_BCL2L10-01       ctg-gcgaggca---gctgagggagcaaacagacatgaacccggggctgg
                            * *           **        *     *            *  

A0A3B3ICL7_BCL2L1-      c-ccgcattgctgaatggatgacccagtacctggatgagcaaataagtcc
A0A3B3ICL7_BCL2L1-      c-ccgcattgctgaatggatgacccagtacctggatgagcaaataagtcc
H2MLZ3_MCL1-01          a-cctggtcagtcaggagatctgcacgtacctg-----------------
H2MLZ3_MCL1-02          a-cctggtcagtcaggagatctgcacgtacctg-----------------
A0A3B3IB64_BCL2L1-      a-ccggattgtggagtggatgaccgtctacctggacaaccacatccagcc
A0A3P9JYH1_BCL2L1-      a-ccggattgtggagtggatgaccgtctacctggacaaccacatccagcc
A0A3P9LM07_BCL2L10      accccgggcgggaagtgg-cgcccgggcctgtgagctgccaggcgctggc
H2MBQ3_BCL2L10-01       accccgggcgggaagtgg-cgcccgggcctgtgagctgccaggcgctggc
                          **         *   *     *       **                 

A0A3B3ICL7_BCL2L1-      -----------atggatcc------acagtcatggaggatgggattgctt
A0A3B3ICL7_BCL2L1-      -----------atggatcc------acagtcatggaggatgggattgctt
H2MLZ3_MCL1-01          -----------ctgagt-----------------gagcagcggaactggc
H2MLZ3_MCL1-02          -----------ctgagt-----------------gagcagcggaactggc
A0A3B3IB64_BCL2L1-      -----------ctggatcc------agagccaaggcggatgggagcgttt
A0A3P9JYH1_BCL2L1-      -----------ctggatcc------agagccaaggcggatgggagcgttt
A0A3P9LM07_BCL2L10      agaaactgtagctgatttcctgggaggagacaagaaagaatgga------
H2MBQ3_BCL2L10-01       agaaactgtagctgatttcctgggaggagacaagaaagaatgga------
                                    **  *                     *  ***      

A0A3B3ICL7_BCL2L1-      tgcacggctgt-atggccagaacggcgctgcagaagcgaggagatttcaa
A0A3B3ICL7_BCL2L1-      tgcacggctgt-atggccagaacggcgctgcagaagcgaggagatttcaa
H2MLZ3_MCL1-01          tggtcaacaacaactcctgggatg--gtttcgt------agagttctttc
H2MLZ3_MCL1-02          tggtcaacaacaactcctgggatg--gtttcgt------agagttctttc
A0A3B3IB64_BCL2L1-      tgct-gaaatctttgggcaggaagccgcggctgagagcagaaggtctcag
A0A3P9JYH1_BCL2L1-      tgct-gaaatctttgggcaggaagccgcggctgagagcagaaggtctcag
A0A3P9LM07_BCL2L10      tgctagaaaatgatggatgggaag--gcttctg------taagttctcca
H2MBQ3_BCL2L10-01       tgctagaaaatgatggatgggaag--gcttctg------taagttctcca
                        **                 * * *  *   *          ** * *   

A0A3B3ICL7_BCL2L1-      gaga-----cgctgaagaagtggat--------gctggtcacagtggccc
A0A3B3ICL7_BCL2L1-      gaga-----cgctgaagaagtggat--------gctggtcacagtggccc
H2MLZ3_MCL1-01          gcgtttcagacccagaaacgacagtcaggaacacttt-----ggtggcct
H2MLZ3_MCL1-02          gcgtttcagacccagaaacgacagtcaggaacacttt-----ggtggcct
A0A3B3IB64_BCL2L1-      gaga-----gcttcaagaagtggct--------gctggtggggatgacg-
A0A3P9JYH1_BCL2L1-      gaga-----gcttcaagaagtggct--------gctggtggggatgacg-
A0A3P9LM07_BCL2L10      gaac-----agccagagaggtgagtcaggactcgtccatgaagactgcgc
H2MBQ3_BCL2L10-01       gaac-----agccagagaggtgagtcaggactcgtccatgaagactgcgc
                        *              * * *    *                      *  

A0A3B3ICL7_BCL2L1-      tttt------aactggact---gctgctgggtgtgctcatcaccaagaaa
A0A3B3ICL7_BCL2L1-      tttt------aactggact---gctgctgggtgtgctcatcaccaagaaa
H2MLZ3_MCL1-01          tccttggaattgctggcgt---------tggggctttactggcccagctt
H2MLZ3_MCL1-02          tccttggaattgctggcgt---------tggggctttactggcccagctt
A0A3B3IB64_BCL2L1-      -----gtggcgaccggcgt---cctggtgggatccttcctcgcccagaaa
A0A3P9JYH1_BCL2L1-      -----gtggcgaccggcgt---cctggtgggatccttcctcgcccagaaa
A0A3P9LM07_BCL2L10      tcttcgcggcggccagcgtgggcctggctggactcaccttcctcctggtg
H2MBQ3_BCL2L10-01       tcttcgcggcggccagcgtgggcctggctggactcaccttcctcctggtg
                                    *  *  *          **        *   *  *   

A0A3B3ICL7_BCL2L1-      --------------------------------------------------
A0A3B3ICL7_BCL2L1-      --------------------------------------------------
H2MLZ3_MCL1-01          agt-----------------------------------------------
H2MLZ3_MCL1-02          aatatgatggccatttttaaaggacttcctgcttctaccagacttcacaa
A0A3B3IB64_BCL2L1-      cgc-----------------------------------------------
A0A3P9JYH1_BCL2L1-      cgc-----------------------------------------------
A0A3P9LM07_BCL2L10      cgc-----------------------------------------------
H2MBQ3_BCL2L10-01       cgc-----------------------------------------------

A0A3B3ICL7_BCL2L1-      ----cggtga
A0A3B3ICL7_BCL2L1-      ----cggtga
H2MLZ3_MCL1-01          ----aggtga
H2MLZ3_MCL1-02          ctcgagatag
A0A3B3IB64_BCL2L1-      ----ctgtga
A0A3P9JYH1_BCL2L1-      ----ctgtga
A0A3P9LM07_BCL2L10      ----tag---
H2MBQ3_BCL2L10-01       ----tag---

© 1998-2019