Dataset for CDS BCL-2-like of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2MLZ3_MCL1-01         ------------atgtttcctttgca--aaaacagatggttaac--agct
H2MBQ3_BCL2L10-01      agagtg---ataaggttctctttacgccgtctcagtgcgcagtt---gct
H2MFY6_BCL2L1-01       caagctcacacaatgtcc------cactgtaacagagagctggtccggtt
                                   * **        *       ***   *        * *

H2MLZ3_MCL1-01         acatcacgtctaactgtggat---ttacgggacacatcctcgg-------
H2MBQ3_BCL2L10-01      tgatatcgctgggaggaaaatgtcttgtggg-------ctgaggaaagag
H2MFY6_BCL2L1-01       ctatttagcctataag---atgtcatgcagggactatcctgtg-------
                         **   *       *   **    *   **       **  *       

H2MLZ3_MCL1-01         ----cagcagagcgggagagatgtccgcgcgcgtgcctctgccgtccaca
H2MBQ3_BCL2L10-01      accctagctgtggccctggattacctgtccctgagctgcaggagcccact
H2MFY6_BCL2L1-01       -tccctgctgaagcccacagacgatgggggagaaactgaagaggaccact
                             ** *                *        *    *  * **** 

H2MLZ3_MCL1-01         ttagcctctcacgtggcaaaccccgacccgtccgatcagctcaaaagacc
H2MBQ3_BCL2L10-01      ccaggccccccc-------acct---cccagcgagtcagctg------ct
H2MFY6_BCL2L1-01       cc-gatgcccgg-------aatc---gcaggctggtcagcagtgaggacg
                          *   * *         *       *   *   *****        * 

H2MLZ3_MCL1-01         gcaggacctcgagtattccgcgaggaggtttcac------------gacg
H2MBQ3_BCL2L10-01      gcca----------------tgaggcg--cctggcccag-------gaca
H2MFY6_BCL2L1-01       gccggc--------------tgaggaggtcctgtccctgttgtgctagca
                       **                   **** *                     * 

H2MLZ3_MCL1-01         tcgacgacgatggctctctccccaacaccccggagttggagtgcgaggcc
H2MBQ3_BCL2L10-01      tggagg----------------cgcagtacca--gcc------------c
H2MFY6_BCL2L1-01       tggacgccatcaaatcaactctcaaagattcg--gccgatgagtttgaac
                       * ** *                *       *   *              *

H2MLZ3_MCL1-01         agcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccac
H2MBQ3_BCL2L10-01      cgcttctcc---------------acc------tt-ag---------cac
H2MFY6_BCL2L1-01       gtcgtttcc---------------atcaaggtttt-agtgatctctccgt
                         * * ***               * *      ** *          *  

H2MLZ3_MCL1-01         ggaattcctcaccaatttctttag----gaactttgttggaatttctcag
H2MBQ3_BCL2L10-01      agaa--cttcaggaagcacagcgggccggacctgtgctccagcctc----
H2MFY6_BCL2L1-01       gcag--cttcat--atcactccagacacggcc--taccaaaacttc----
                         *   * ***   *   *    *    *  *  *     *   **    

H2MLZ3_MCL1-01         tatcggcaccgggataataaatacatgtcgaccgcgaaaagagtggtgaa
H2MBQ3_BCL2L10-01      ------------------------------------aggaaggtgatgga
H2MFY6_BCL2L1-01       ------------------------------------aaaagggtgttgga
                                                           *  *  *** ** *

H2MLZ3_MCL1-01         cgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagac
H2MBQ3_BCL2L10-01      ggagctggtggg--------------------------------------
H2MFY6_BCL2L1-01       tgagctgttcaa--------------------------------------
                        **  ** *                                         

H2MLZ3_MCL1-01         tgtcgttggacgaccagggggatgatatgtcatttgtcagcagcgtagcg
H2MBQ3_BCL2L10-01      --------------------------------------------------
H2MFY6_BCL2L1-01       --------------------------------------------------
                                                                         

H2MLZ3_MCL1-01         aagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcct
H2MBQ3_BCL2L10-01      --------------agatgaacgcttgaactgggggagggtcgtttccct
H2MFY6_BCL2L1-01       --------------ggatg---ggatcaactgggggcgcgttgtgggttt
                                      ****        ********  *  * **     *

H2MLZ3_MCL1-01         gctggccttcggggcggcg---gtgtgtcagtc-----------------
H2MBQ3_BCL2L10-01      ttttgcattcgtgggagtgctggcgaggcagctgagggagcaaacagaca
H2MFY6_BCL2L1-01       gtttgtctttggtggtgcgct-gtgtgtcgagtgtg--------------
                         * *  ** *  *  * *   * * * *                     

H2MLZ3_MCL1-01         ------------------cttgaaggaaaagggcagaggtcactgcg---
H2MBQ3_BCL2L10-01      tgaacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagc
H2MFY6_BCL2L1-01       ------------------tcgagaggaatatgg-----------gtgagc
                                               ** *   **           * *   

H2MLZ3_MCL1-01         tggacctggtcagt--caggagatctgcacgtacctgctgagtgagcagc
H2MBQ3_BCL2L10-01      tg---ccaggcgctggcagaaactgta-gctgatttcctgggaggagaca
H2MFY6_BCL2L1-01       tggtctcccgcatt-gctgaatggatg-acccagtacctggatgagcaaa
                       **        *  *  * * *    *   *  *    ***   *   *  

H2MLZ3_MCL1-01         ggaac---tggctggtcaacaacaactcctgggatggtttcgtagagttc
H2MBQ3_BCL2L10-01      agaaagaatggatgctagaaaatgatggatgggaaggctt-------ctg
H2MFY6_BCL2L1-01       taagtccatggatccacagtcatggaggatgggattgctttgcacggctg
                         *     *** *        *       *****  * **        * 

H2MLZ3_MCL1-01         tttcgcgtttcaga-----cccagaaacgacag------tcaggaacact
H2MBQ3_BCL2L10-01      taa-gttctccagaaca--gccagagaggtgag------tcagg-actcg
H2MFY6_BCL2L1-01       tat-g---gccagaacggcgctgcagaagcgaggagatttcaag-agacg
                       *   *     ****      *   * * *  **      *** * *  * 

H2MLZ3_MCL1-01         ttggtg------gccttccttggaattgct-----ggcgttggggcttta
H2MBQ3_BCL2L10-01      tccatgaagactgcgctcttcgcggcggcc-----agcg-tgggc-----
H2MFY6_BCL2L1-01       ctgaagaagtggatgctggtcacagtggcccttttaac--tggactgctg
                            *          *  *       **        *  ***       

H2MLZ3_MCL1-01         ctggcccagctta------------gtaggtga
H2MBQ3_BCL2L10-01      ctggctggactcaccttcctcctggtgcgctag
H2MFY6_BCL2L1-01       ctgggtgtgctca---tcaccaagaaacggtga
                       ****     ** *               * *  

© 1998-2018