Dataset for CDS BCL-2-like of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2MBQ3_BCL2L10-01      atgtcttgtgggctgaggaaagagac-------------------cctag
H2MLZ3_MCL1-01         atgtttcct---ttgcaaaaacagatggttaacagctacatcacgtctaa
H2MLZ3_MCL1-02         atgtttcct---ttgcaaaaacagatggttaacagctacatcacgtctaa
                       **** *  *    **   *** ***                     *** 

H2MBQ3_BCL2L10-01      ctgtggccctggattacctgtccctgagctgcagga--------------
H2MLZ3_MCL1-01         ctgtggatttacgggacacatcctcg-gcagcagagcgggagagatgtcc
H2MLZ3_MCL1-02         ctgtggatttacgggacacatcctcg-gcagcagagcgggagagatgtcc
                       ******   *     **   ***  * ** ****                

H2MBQ3_BCL2L10-01      -----------------gcccactccaggccccc----------ccacct
H2MLZ3_MCL1-01         gcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccga
H2MLZ3_MCL1-02         gcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccga
                                        * ****   ** * * *          ** *  

H2MBQ3_BCL2L10-01      cccagcgagtcagc-------------------------tgctgccatga
H2MLZ3_MCL1-01         cccgtccgatcagctcaaaagaccgcaggacctcgagtattccgcgagga
H2MLZ3_MCL1-02         cccgtccgatcagctcaaaagaccgcaggacctcgagtattccgcgagga
                       ***  *   *****                         * * ** * **

H2MBQ3_BCL2L10-01      ggcgcc----------------tggccc--------aggacatggaggcg
H2MLZ3_MCL1-01         ggtttcacgacgtcgacgacgatggctctctccccaacaccccggagttg
H2MLZ3_MCL1-02         ggtttcacgacgtcgacgacgatggctctctccccaacaccccggagttg
                       **   *                **** *        *   *  ****  *

H2MBQ3_BCL2L10-01      cagtaccagccccgcttctc---------------------caccttag-
H2MLZ3_MCL1-01         gagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaa
H2MLZ3_MCL1-02         gagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaa
                        *** * ** ** ** * **                     * * ***  

H2MBQ3_BCL2L10-01      ---------cacagaa--------------cttcaggaa-----------
H2MLZ3_MCL1-01         cgaggacaccacggaattcctcaccaatttctttaggaactttgttggaa
H2MLZ3_MCL1-02         cgaggacaccacggaattcctcaccaatttctttaggaactttgttggaa
                                *** ***              *** *****           

H2MBQ3_BCL2L10-01      -------------gcacagcgggccggacctgtgctccagcctcaggaag
H2MLZ3_MCL1-01         tttctcagtatcggcaccg-ggataataaatacatgtcgaccgcgaaaag
H2MLZ3_MCL1-02         tttctcagtatcggcaccg-ggataataaatacatgtcgaccgcgaaaag
                                    **** * **     *  *      *  ** *   ***

H2MBQ3_BCL2L10-01      -gtgatggaggagctggtgggagatgaacgcttga------actggggga
H2MLZ3_MCL1-01         agtggtgaacga---cgtgttagagaaacacaagattacttacaacggta
H2MLZ3_MCL1-02         agtggtgaacga---cgtgttagagaaacacaagattacttacaacggta
                        *** ** * **    ***  ***  *** *  **      **   ** *

H2MBQ3_BCL2L10-01      gggtcgt----ttccctttttgcattcgtgggagtgct------------
H2MLZ3_MCL1-01         tgatcgtcagactgtcgttggacgaccagggggatgatatgtcatttgtc
H2MLZ3_MCL1-02         tgatcgtcagactgtcgttggacgaccagggggatgatatgtcatttgtc
                        * ****     *  * **   *   *  ***  ** *            

H2MBQ3_BCL2L10-01      ggcgaggcagctgaggga------gcaaacaga--catgaacccggggct
H2MLZ3_MCL1-01         agcagcgtagcgaagagcctttttgcggatgggaccaccaa-ctggggcc
H2MLZ3_MCL1-02         agcagcgtagcgaagagcctttttgcggatgggaccaccaa-ctggggcc
                        **   * ***  ** *       **  *  *   **  ** * ***** 

H2MBQ3_BCL2L10-01      ggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctgg
H2MLZ3_MCL1-01         gcatcgtcagcctgc--tggccttcggggcggcggtgtgtcagtccttga
H2MLZ3_MCL1-02         gcatcgtcagcctgc--tggccttcggggcggcggtgtgtcagtccttga
                       * * *    **  *   ****   **** * * *   ** *** *  ** 

H2MBQ3_BCL2L10-01      cagaaac-----------------tgtagctgat----------------
H2MLZ3_MCL1-01         aggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgc
H2MLZ3_MCL1-02         aggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgc
                         ****                  ** * *** *                

H2MBQ3_BCL2L10-01      ---ttcctgggaggagacaagaaagaatggatgctagaaaatgatggatg
H2MLZ3_MCL1-01         acgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctg
H2MLZ3_MCL1-02         acgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctg
                          * ****    * **  **    * *** ** *  * **  *    **

H2MBQ3_BCL2L10-01      ggaaggcttctgtaagttctccag-----aacagccagagaggtgagtca
H2MLZ3_MCL1-01         ggatggtttcgtagagttctttcgcgtttcagacccagaaacgacagtca
H2MLZ3_MCL1-02         ggatggtttcgtagagttctttcgcgtttcagacccagaaacgacagtca
                       *** ** ***    ******   *      * * ***** * *  *****

H2MBQ3_BCL2L10-01      ggactcgtccatgaagactgcgctcttcgcggcggccagcgt--gggcct
H2MLZ3_MCL1-01         gga-----acactttggtggccttccttggaattgctggcgttggggctt
H2MLZ3_MCL1-02         gga-----acactttggtggccttccttggaattgctggcgttggggctt
                       ***      **    *   **  ** * *     **  ****  **** *

H2MBQ3_BCL2L10-01      ggctggactcacctt------------------------cctcctggtgc
H2MLZ3_MCL1-01         tactgg-cccagcttagt--------------------------------
H2MLZ3_MCL1-02         tactgg-cccagcttaatatgatggccatttttaaaggacttcctgcttc
                         **** * ** ***                                   

H2MBQ3_BCL2L10-01      --------------------gctag
H2MLZ3_MCL1-01         -------------------aggtga
H2MLZ3_MCL1-02         taccagacttcacaactcgagatag
                                           * *  

© 1998-2019