Dataset for CDS BCL2L10 of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9LM07_BCL2L10      atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacct
H2MBQ3_BCL2L10-01       atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacct
                        **************************************************

A0A3P9LM07_BCL2L10      gtccctgagctgcaggagcccactccaggcccccccacctcccagcgagt
H2MBQ3_BCL2L10-01       gtccctgagctgcaggagcccactccaggcccccccacctcccagcgagt
                        **************************************************

A0A3P9LM07_BCL2L10      cagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccag
H2MBQ3_BCL2L10-01       cagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccag
                        **************************************************

A0A3P9LM07_BCL2L10      ccccgcttctccaccttagcacagaacttcaggaagcacagcgggccgga
H2MBQ3_BCL2L10-01       ccccgcttctccaccttagcacagaacttcaggaagcacagcgggccgga
                        **************************************************

A0A3P9LM07_BCL2L10      cctgtgctccagcctcaggaaggtgatggaggagctggtgggagatgaac
H2MBQ3_BCL2L10-01       cctgtgctccagcctcaggaaggtgatggaggagctggtgggagatgaac
                        **************************************************

A0A3P9LM07_BCL2L10      gcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctg
H2MBQ3_BCL2L10-01       gcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctg
                        **************************************************

A0A3P9LM07_BCL2L10      gcgaggcagctgagggagcaaacagacatgaacccggggctggaccccgg
H2MBQ3_BCL2L10-01       gcgaggcagctgagggagcaaacagacatgaacccggggctggaccccgg
                        **************************************************

A0A3P9LM07_BCL2L10      gcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactg
H2MBQ3_BCL2L10-01       gcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactg
                        **************************************************

A0A3P9LM07_BCL2L10      tagctgatttcctgggaggagacaagaaagaatggatgctagaaaatgat
H2MBQ3_BCL2L10-01       tagctgatttcctgggaggagacaagaaagaatggatgctagaaaatgat
                        **************************************************

A0A3P9LM07_BCL2L10      ggatgggaaggcttctgtaagttctccagaacagccagagaggtgagtca
H2MBQ3_BCL2L10-01       ggatgggaaggcttctgtaagttctccagaacagccagagaggtgagtca
                        **************************************************

A0A3P9LM07_BCL2L10      ggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctgg
H2MBQ3_BCL2L10-01       ggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctgg
                        **************************************************

A0A3P9LM07_BCL2L10      ctggactcaccttcctcctggtgcgctag
H2MBQ3_BCL2L10-01       ctggactcaccttcctcctggtgcgctag
                        *****************************

© 1998-2019