Dataset for CDS BCL2L1 of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3IB64_BCL2L1-      atgtccc---ggaacagagaactggttgttttctacgtgaagtataaact
A0A3P9JYH1_BCL2L1-      atgtccc---ggaacagagaactggttgttttctacgtgaagtataaact
A0A3P9MKK4_BCL2L1-      atgtcccactgtaacagagagctggtccggttctatttagcctacaagat
A0A3P9MKK4_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctacaagat
A0A3B3I2Q5_BCL2L1-      atgtcccactgtaacagagagctggtccggttctatttagcctataagat
A0A3B3I2Q5_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctataagat
A0A3P9I2N4_BCL2L1-      atgtcccactgtaacagggagctggttcggttctatttagcctataagat
A0A3P9I2N4_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctataagat
                        *** *     * ** *       *          *  *    ** **  *

A0A3B3IB64_BCL2L1-      gtctcagaggaactaccccctcaaccacatagtgctcaatgagtctccga
A0A3P9JYH1_BCL2L1-      gtctcagaggaactaccccctcaaccacatagtgctcaatgagtctccga
A0A3P9MKK4_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
A0A3P9MKK4_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
A0A3B3I2Q5_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
A0A3B3I2Q5_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
A0A3P9I2N4_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
A0A3P9I2N4_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
                        ***    *** **** **  *          ** *    ***  * *   

A0A3B3IB64_BCL2L1-      acaggactgctgcgggggaggtgggcgaggagca-----gagcacggaga
A0A3P9JYH1_BCL2L1-      acaggactgctgcgggggaggtgggcgaggagca-----gagcacggaga
A0A3P9MKK4_BCL2L1-      acaga--cgatgggggagaaactgaagaggaccactccgctgcccggaat
A0A3P9MKK4_BCL2L1-      acaga--cgatgggggagaaactgaagaggaccactccgctgcccggaat
A0A3B3I2Q5_BCL2L1-      acaga--cgatgggggagaaactgaagaggaccactccgatgcccggaat
A0A3B3I2Q5_BCL2L1-      acaga--cgatgggggagaaactgaagaggaccactccgatgcccggaat
A0A3P9I2N4_BCL2L1-      acaga--tgatgggggagaaactgaagaggaccactccgctgcccggaac
A0A3P9I2N4_BCL2L1-      acaga--tgatgggggagaaactgaagaggaccactccgctgcccggaac
                        ****    * ** *** **    *  ***** **       ** ****  

A0A3B3IB64_BCL2L1-      cgcacgccaacgggacgtttaacgggacaactcccgggaccccgccgctc
A0A3P9JYH1_BCL2L1-      cgcacgccaacgggacgtttaacgggacaactcccgggacccccccgctc
A0A3P9MKK4_BCL2L1-      ggcaggccggtcagcagtgaggactgccagctgaggaggtc------ctg
A0A3P9MKK4_BCL2L1-      ggcaggccggtcagcagtgaggactgccagctgaggaggtc------ctg
A0A3B3I2Q5_BCL2L1-      cgcaggctggtcagcagtgaggacggccggctgaggaggtc------ctg
A0A3B3I2Q5_BCL2L1-      cgcaggctggtcagcagtgaggacggccggctgaggaggtc------ctg
A0A3P9I2N4_BCL2L1-      ggcaggcaggtcagcagtgaggacggccagctgaggaggtc------ctg
A0A3P9I2N4_BCL2L1-      ggcaggcaggtcagcagtgaggacggccagctgaggaggtc------ctg
                         *** **      *  **       * *  **   * *  *      ** 

A0A3B3IB64_BCL2L1-      tccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgcagt
A0A3P9JYH1_BCL2L1-      tccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgcagt
A0A3P9MKK4_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
A0A3P9MKK4_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
A0A3B3I2Q5_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
A0A3B3I2Q5_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
A0A3P9I2N4_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
A0A3P9I2N4_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
                        **** * ** *                       * * *********  *

A0A3B3IB64_BCL2L1-      gaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccc
A0A3P9JYH1_BCL2L1-      gaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccc
A0A3P9MKK4_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
A0A3P9MKK4_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
A0A3B3I2Q5_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
A0A3B3I2Q5_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
A0A3P9I2N4_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
A0A3P9I2N4_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
                         **     * ***   **  ***** * ***** ** *  ** * *   *

A0A3B3IB64_BCL2L1-      ttgccttcaacaacctgcacagccagctgcacatcacgcccgccacggcc
A0A3P9JYH1_BCL2L1-      tggccttcaacaacctgcacagccagctgcacatcacgcccgccacggcc
A0A3P9MKK4_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccggacacggcc
A0A3P9MKK4_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccggacacggcc
A0A3B3I2Q5_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccagacacggcc
A0A3B3I2Q5_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccagacacggcc
A0A3P9I2N4_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccggacacggcc
A0A3P9I2N4_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccggacacggcc
                          *  ** *   * **   *   ***** ** ***** ** * *******

A0A3B3IB64_BCL2L1-      taccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaa
A0A3P9JYH1_BCL2L1-      taccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaa
A0A3P9MKK4_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
A0A3P9MKK4_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
A0A3B3I2Q5_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
A0A3B3I2Q5_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
A0A3P9I2N4_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
A0A3P9I2N4_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
                        ***** * **** * *  *** ** * *********   **    *****

A0A3B3IB64_BCL2L1-      ctggggccgcatcgtggggctcttcgcattcggcggggcgctgtgcgtgg
A0A3P9JYH1_BCL2L1-      ctggggccgcatcgtggggctcttcgcattcggcggggcgctgtgcgtgg
A0A3P9MKK4_BCL2L1-      ctgggggcgcgttgtgggtttatttgtctttggtggtgcgctgtgtgtcg
A0A3P9MKK4_BCL2L1-      ctgggggcgcgttgtgggtttatttgtctttggtggtgcgctgtgtgtcg
A0A3B3I2Q5_BCL2L1-      ctgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcg
A0A3B3I2Q5_BCL2L1-      ctgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcg
A0A3P9I2N4_BCL2L1-      ctgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcg
A0A3P9I2N4_BCL2L1-      ctgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcg
                        ****** *** * *****  * ** *  ** ** ** ******** ** *

A0A3B3IB64_BCL2L1-      agtgcgttgagaaggagatgagccccctggtggaccggattgtggagtgg
A0A3P9JYH1_BCL2L1-      agtgcgttgagaaggagatgagccccctggtggaccggattgtggagtgg
A0A3P9MKK4_BCL2L1-      agtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatgg
A0A3P9MKK4_BCL2L1-      agtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatgg
A0A3B3I2Q5_BCL2L1-      agtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatgg
A0A3B3I2Q5_BCL2L1-      agtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatgg
A0A3P9I2N4_BCL2L1-      agtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatgg
A0A3P9I2N4_BCL2L1-      agtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatgg
                        **** ** **** * * *** *    *****   *** ****  ** ***

A0A3B3IB64_BCL2L1-      atgaccgtctacctggacaaccacatccagccctggatccagagccaagg
A0A3P9JYH1_BCL2L1-      atgaccgtctacctggacaaccacatccagccctggatccagagccaagg
A0A3P9MKK4_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
A0A3P9MKK4_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
A0A3B3I2Q5_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
A0A3B3I2Q5_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
A0A3P9I2N4_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
A0A3P9I2N4_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
                        ******   ********  * ** **    ** ******** ** ** **

A0A3B3IB64_BCL2L1-      cggatgggagcgttttgctgaaatctttgggcaggaagccgcggctgaga
A0A3P9JYH1_BCL2L1-      cggatgggagcgttttgctgaaatctttgggcaggaagccgcggctgaga
A0A3P9MKK4_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgctgcagaag
A0A3P9MKK4_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgctgcagaag
A0A3B3I2Q5_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgctgcagaag
A0A3B3I2Q5_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgctgcagaag
A0A3P9I2N4_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgccgcagaag
A0A3P9I2N4_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgccgcagaag
                         ********  * *****     * * *** *** * * *** ** **  

A0A3B3IB64_BCL2L1-      gcagaaggtctcaggagagcttcaagaagtggctgctggtggggatgacg
A0A3P9JYH1_BCL2L1-      gcagaaggtctcaggagagcttcaagaagtggctgctggtggggatgacg
A0A3P9MKK4_BCL2L1-      cgaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcc
A0A3P9MKK4_BCL2L1-      cgaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcc
A0A3B3I2Q5_BCL2L1-      cgaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcc
A0A3B3I2Q5_BCL2L1-      cgaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcc
A0A3P9I2N4_BCL2L1-      caaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcc
A0A3P9I2N4_BCL2L1-      caaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcc
                          ** ** * *** ****   * ********* *******     ** * 

A0A3B3IB64_BCL2L1-      gtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtg
A0A3P9JYH1_BCL2L1-      gtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtg
A0A3P9MKK4_BCL2L1-      cttttaactggactgctgcttggtgtgctcatcaccaagaaacg---gtg
A0A3P9MKK4_BCL2L1-      cttttaactggactgctgcttggtgtgctcatcaccaagaaacg---gtg
A0A3B3I2Q5_BCL2L1-      cttttaactggactgctgctgggtgtgctcatcaccaagaaacg---gtg
A0A3B3I2Q5_BCL2L1-      cttttaactggactgctgctgggtgtgctcatcaccaagaaacg---gtg
A0A3P9I2N4_BCL2L1-      cttttaactggactgctgctgggtgtgctcatcaccaagaaacg---gtg
A0A3P9I2N4_BCL2L1-      cttttaactggactgctgctgggtgtgctcatcaccaagaaacg---gtg
                         *    ** **  * *** * **     ** ** ** *******   ***

A0A3B3IB64_BCL2L1-      a
A0A3P9JYH1_BCL2L1-      a
A0A3P9MKK4_BCL2L1-      a
A0A3P9MKK4_BCL2L1-      a
A0A3B3I2Q5_BCL2L1-      a
A0A3B3I2Q5_BCL2L1-      a
A0A3P9I2N4_BCL2L1-      a
A0A3P9I2N4_BCL2L1-      a
                        *

© 1998-2019