Dataset for CDS MCL-1 of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1T2Q0_MCL1-01      atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccggg
G1T2Q0_MCL1-02      atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccggg
                    ************************************************************

G1T2Q0_MCL1-01      ttgggagccggtggcggcggcgtcgcccctccggcagagcggcttttggctgcggagaag
G1T2Q0_MCL1-02      ttgggagccggtggcggcggcgtcgcccctccggcagagcggcttttggctgcggagaag
                    ************************************************************

G1T2Q0_MCL1-01      gaggccgcggcccggctagaggtagggggaggggaggccggcgcggtgattggcggaagc
G1T2Q0_MCL1-02      gaggccgcggcccggctagaggtagggggaggggaggccggcgcggtgattggcggaagc
                    ************************************************************

G1T2Q0_MCL1-01      ccgggcgct---------------------------------------------------
G1T2Q0_MCL1-02      ccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcgcgcggccggcg
                    *********                                                   

G1T2Q0_MCL1-01      ---attggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtacttggcg
G1T2Q0_MCL1-02      cccattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtacttggcg
                       *********************************************************

G1T2Q0_MCL1-01      cccacccgccgcgcgtcgccgctcgaggagatggaagccccggctgcggacgccatcatg
G1T2Q0_MCL1-02      cccacccgccgcgcgtcgccgctcgaggagatggaagccccggctgcggacgccatcatg
                    ************************************************************

G1T2Q0_MCL1-01      tcgcccgaagaggagctggacggctacgagccggagccccttgcgaagcggccggccgtc
G1T2Q0_MCL1-02      tcgcccgaagaggagctggacggctacgagccggagccccttgcgaagcggccggccgtc
                    ************************************************************

G1T2Q0_MCL1-01      ctgcccctgctggacttggtgggggaggccagtaaggtccctagcacggacgggtcgctg
G1T2Q0_MCL1-02      ctgcccctgctggacttggtgggggaggccagtaaggtccctagcacggacgggtcgctg
                    ************************************************************

G1T2Q0_MCL1-01      ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggag
G1T2Q0_MCL1-02      ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggag
                    ************************************************************

G1T2Q0_MCL1-01      attatcgcccggtaccttcgggagcaggcgaccggcgccaaggacgcgaagccgatgggc
G1T2Q0_MCL1-02      attatcgcccggtaccttcgggagcaggcgaccggcgccaaggacgcgaagccgatgggc
                    ************************************************************

G1T2Q0_MCL1-01      cgggccggcagcgcgagccggaaggcgctcgagaccctgcggcgggtcggggacggtgtg
G1T2Q0_MCL1-02      cgggccggcagcgcgagccggaaggcgctcgagaccctgcggcgggtcggggacggtgtg
                    ************************************************************

G1T2Q0_MCL1-01      cagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaa
G1T2Q0_MCL1-02      cagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaa
                    ************************************************************

G1T2Q0_MCL1-01      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaac
G1T2Q0_MCL1-02      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaac
                    ************************************************************

G1T2Q0_MCL1-01      tggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttgaagagc
G1T2Q0_MCL1-02      tggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttgaagagc
                    ************************************************************

G1T2Q0_MCL1-01      ataaaccaagaaagctgcatagaacctttagcggaaagtatcacagatgttctcgtcagg
G1T2Q0_MCL1-02      ataaaccaagaaagctgcatagaacctttagcggaaagtatcacagatgttctcgtcagg
                    ************************************************************

G1T2Q0_MCL1-01      acgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
G1T2Q0_MCL1-02      acgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
                    ************************************************************

G1T2Q0_MCL1-01      gtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccgga
G1T2Q0_MCL1-02      gtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccgga
                    ************************************************************

G1T2Q0_MCL1-01      gtaggagcggggctggcttatctgataagatag
G1T2Q0_MCL1-02      gtaggagcggggctggcttatctgataaga---
                    ******************************   

© 1998-2019