Dataset for CDS BCL-2-like of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1T1L8_BCL2A1-01       ---------------------------------------atgttcgcctc
G1TW27_BCL2-01         --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1T2Q0_MCL1-02         --atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttg
G1T2Q0_MCL1-01         --atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttg
G1TV33_BCL2L2-01       ctgagcctctgtct-acatattcccgatattcatgccggtctttcatcct
Q9MYW4_BCL2L1-01       --------atgtctcagagcaaccgggagctggtggttgactttctctcc

G1T1L8_BCL2A1-01       ccagggctt------------------------------------cggaa
G1TW27_BCL2-01         --atggcgcacgccgggcgaacagggtacgacaac----------cggga
G1T264_BCL2L10-01      ---aggccccag-cgg--aggctgg-----------------ccatggca
G1T2Q0_MCL1-02         ggggggcccgggttgg--gagccggtggcggcggcgtcgcccctccggca
G1T2Q0_MCL1-01         ggggggcccgggttgg--gagccggtggcggcggcgtcgcccctccggca
G1TV33_BCL2L2-01       tgc---ctct-----------ta----------------------cagcc
Q9MYW4_BCL2L1-01       tacaagctttcgcagaaaggata----------------------cagct
                             *                                        *  

G1T1L8_BCL2A1-01       g---------------cttccagaagaagcagtcaccggctctgct----
G1TW27_BCL2-01         g-----a-----------tcgtgatgaagtaca-------tccactataa
G1T264_BCL2L10-01      g-----a---------cgctttggaggagcgcactgcgcgcctgct----
G1T2Q0_MCL1-02         g-----agcggcttttggctgcggagaaggaggccgcggcccggctagag
G1T2Q0_MCL1-01         g-----agcggcttttggctgcggagaaggaggccgcggcccggctagag
G1TV33_BCL2L2-01       g---------------------------------------cccg------
Q9MYW4_BCL2L1-01       ggagtcagtttagtgatgtggaagagaacaggactgaggccccggaaggg
                       *                                        *        

G1T1L8_BCL2A1-01       --------------------------------------------------
G1TW27_BCL2-01         gctgtcccagaggggctacgagtgg-------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1T2Q0_MCL1-02         gtagggggaggggaggccggcgcggtgattggcggaagcccgggcgctag
G1T2Q0_MCL1-01         gtagggggaggggaggccggcgcggtgattggcggaagcccgggcgct--
G1TV33_BCL2L2-01       -----------gatg-----------------------------------
Q9MYW4_BCL2L1-01       actggaccagagatg-----------------------------------

G1T1L8_BCL2A1-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1T2Q0_MCL1-02         ccccccggccgcgctggcgccggacgcccggagggtcgcgcggccggcgc
G1T2Q0_MCL1-01         --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
Q9MYW4_BCL2L1-01       --------------------------------------------------

G1T1L8_BCL2A1-01       -------ctccgagcagcagaagatgagtga-----ctgcgag-------
G1TW27_BCL2-01         -----gacgctggg------gacgcgggcgccgcctccgcg---------
G1T264_BCL2L10-01      -------caccga-ctacctgg----agtgctgcgcccgcgag-------
G1T2Q0_MCL1-02         ccattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctg
G1T2Q0_MCL1-01         --attggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctg
G1TV33_BCL2L2-01       -----------gcga-ccccagcctcagccccagacacacgg--------
Q9MYW4_BCL2L1-01       -----------gagacccccagtgccatcaatggcaacccag--------
                                  *                           *          

G1T1L8_BCL2A1-01       --tttggc--------------tatgtgcacacac---------------
G1TW27_BCL2-01         --ccgggcgtcttctcctccca---gcccgcgccc---gctgcgccccgg
G1T264_BCL2L10-01      --cccggcacccctgagccgcagccgtccacgccg---gagg--------
G1T2Q0_MCL1-02         tacttggcgcccacccgccgcg--cgtcgccgctc---gaggagatggaa
G1T2Q0_MCL1-01         tacttggcgcccacccgccgcg--cgtcgccgctc---gaggagatggaa
G1TV33_BCL2L2-01       --gct-----ctg------gtggccgactttgtag--------gctacaa
Q9MYW4_BCL2L1-01       --cctggcacccg------gcggacagccccgcggtgaacggagccactg

G1T1L8_BCL2A1-01       ----tggctcaggactatctgctgtacatcctgaagacgccacagcctgg
G1TW27_BCL2-01         gacccggccgccaggacctcgccgccgcc---------gccgccggccgc
G1T264_BCL2L10-01      ----cggctg------------tgctgc----------gctg--tgcggc
G1T2Q0_MCL1-02         gccccggctgcggacgccatcatgtcgcccgaagaggagctg--gacggc
G1T2Q0_MCL1-01         gccccggctgcggacgccatcatgtcgcccgaagaggagctg--gacggc
G1TV33_BCL2L2-01       gctgaggcagaagggttatgtctgtggg----------------gctggc
Q9MYW4_BCL2L1-01       gccacagcagcag---------tttgga-------------------tgc
                             **                                        * 

G1T1L8_BCL2A1-01       actgggaccgagcaaaacg-------------------------------
G1TW27_BCL2-01         cgcggg--------------------------------gcccgcgctcag
G1T264_BCL2L10-01      cacg--------------------------------------cagct---
G1T2Q0_MCL1-02         tacgagccggagccccttgcgaagcggccggccgtcctgcccctgctgga
G1T2Q0_MCL1-01         tacgagccggagccccttgcgaagcggccggccgtcctgcccctgctgga
G1TV33_BCL2L2-01       cctggagagggccc----g-------------------------------
Q9MYW4_BCL2L1-01       ccgggaggtgatccccatg-------------------------------

G1T1L8_BCL2A1-01       --------------tccagggtgctgcagaa----------------cgt
G1TW27_BCL2-01         cccggtgcca----cctgtggtccacctgac-------------------
G1T264_BCL2L10-01      --------------tcagcgggtccactggc---------------cctt
G1T2Q0_MCL1-02         cttggtgggggaggccagtaaggtccctagcacggacgggtcgctgccct
G1T2Q0_MCL1-01         cttggtgggggaggccagtaaggtccctagcacggacgggtcgctgccct
G1TV33_BCL2L2-01       --------------gcagctaacccgctgca-------------------
Q9MYW4_BCL2L1-01       --------------acagcag------tgaa-------------------

G1T1L8_BCL2A1-01       caccttctccatcca-gcaagaagtggaagaggctctgcaaccgtacctg
G1TW27_BCL2-01         --cctccgcc-----------aggcgggcgacgacttctcccggcgct--
G1T264_BCL2L10-01      cttctccgtctaccgc-----------------ggctaccccggcaaccg
G1T2Q0_MCL1-02         cgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcg
G1T2Q0_MCL1-01         cgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcg
G1TV33_BCL2L2-01       -------ccaagccatgcgggcagccggagatgagttcgagacccgcttc
Q9MYW4_BCL2L1-01       -------gcaggctctgagggaggcaggcgacgagtttgaactgcggtac

G1T1L8_BCL2A1-01       cacaatgtgcctgtc------------------gcgtccg----------
G1TW27_BCL2-01         ---------accgcc------------------gcgactt----------
G1T264_BCL2L10-01      c--------atc---------------gagctggcggcgcgcgtggcgga
G1T2Q0_MCL1-02         ctggagattatcgcccggtaccttcgggagcaggcgaccggcgccaagga
G1T2Q0_MCL1-01         ctggagattatcgcccggtaccttcgggagcaggcgaccggcgccaagga
G1TV33_BCL2L2-01       cggcaaaacttctcc------------gacctggccgctc----------
Q9MYW4_BCL2L1-01       cggcgggcattcagc------------gacctgacatccc----------
                                                         *  *            

G1T1L8_BCL2A1-01       --------------------------------------------------
G1TW27_BCL2-01         cgcggagatgtccagccagctgcacc-------------------tgacg
G1T264_BCL2L10-01      ggccgtgctctccgac-ggccacgacctcagctggggccgcgtggtgacg
G1T2Q0_MCL1-02         cgcgaag----ccgatgggccgggccggcagcgcgagccg---gaaggcg
G1T2Q0_MCL1-01         cgcgaag----ccgatgggccgggccggcagcgcgagccg---gaaggcg
G1TV33_BCL2L2-01       -----------------agttgca---------------------tgtga
Q9MYW4_BCL2L1-01       -----------------agctcca---------------------catca

G1T1L8_BCL2A1-01       ---tcgagactgccaggacaattttcaaccaagtga------------tg
G1TW27_BCL2-01         ccctt--tcacgcgagggggcgctttgccacggtgg------------tg
G1T264_BCL2L10-01      ctcgtgacctt-cgccgggacgcttctggacagagggccgc---------
G1T2Q0_MCL1-02         ctcgagaccctgcggcgggtcg----gggacggtgtgcagcgcaaccacg
G1T2Q0_MCL1-01         ctcgagaccctgcggcgggtcg----gggacggtgtgcagcgcaaccacg
G1TV33_BCL2L2-01       ccccaggctcagcacagcagagcttcacccaggtct------------gc
Q9MYW4_BCL2L1-01       ccccagggacagcatatcagagctttgaacaagtag------------tg
                                   *                   *                 

G1T1L8_BCL2A1-01       gagaaagagtttgag-----------------------------------
G1TW27_BCL2-01         gaggagctcttcagg-----------------------------------
G1T264_BCL2L10-01      cggtgaccacccag------------------------------------
G1T2Q0_MCL1-02         agacggccttccaaggaatgcttcggaaactggacatcaaaaacgaagac
G1T2Q0_MCL1-01         agacggccttccaaggaatgcttcggaaactggacatcaaaaacgaagac
G1TV33_BCL2L2-01       gatgaacttttccaa-----------------------------------
Q9MYW4_BCL2L1-01       aacgaactcttccgg-----------------------------------

G1T1L8_BCL2A1-01       ------------------------------------------gatggtgt
G1TW27_BCL2-01         ---------------------------------------------gatgg
G1T264_BCL2L10-01      ------------------cgggtga--------------------ggagg
G1T2Q0_MCL1-02         gatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgt
G1T2Q0_MCL1-01         gatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgt
G1TV33_BCL2L2-01       ---------------------------------------------agggg
Q9MYW4_BCL2L1-01       ---------------------------------------------gatgg

G1T1L8_BCL2A1-01       gatcaactggggcaggattgtgaccatatttgcattcgaagg------gg
G1TW27_BCL2-01         ggtgaactgggggaggattgtggccttctttgagttcggtgg------gg
G1T264_BCL2L10-01      aatgaaatcgcccgggactgcca--------gcgcttggtggccttgctg
G1T2Q0_MCL1-02         aacaaactggggcaggattgtgactctgatttctttcggtgcctttgtgg
G1T2Q0_MCL1-01         aacaaactggggcaggattgtgactctgatttctttcggtgcctttgtgg
G1TV33_BCL2L2-01       tcccaactggggccgcgtggtggccttctttgcctttggggc------cg
Q9MYW4_BCL2L1-01       ggtgaactggggccgcattgtggcctttttctccttcggcgg------gg
                           ** * *    *    *               * *  *        *

G1T1L8_BCL2A1-01       tcctg---gccaagaagctcctccaggag-----caggctgttccggatg
G1TW27_BCL2-01         tcatgtgtgtggagagcgtcaaccgggag------atgtcgcccctggtg
G1T264_BCL2L10-01      t---gcgctcg---------------------------------------
G1T2Q0_MCL1-02         ccaaacacttgaagagcataaaccaagaaagctgcatagaacctttagcg
G1T2Q0_MCL1-01         ccaaacacttgaagagcataaaccaagaaagctgcatagaacctttagcg
G1TV33_BCL2L2-01       cactgtgtgctgagagcgtcaacaaggag------atggagcccctggtg
Q9MYW4_BCL2L1-01       cactgtgcgtggaaagcgtggacaaggag------atggaggtattggtg

G1T1L8_BCL2A1-01       tggacacgttcaagtccatcccttattttgtggctgagttcataacgagg
G1TW27_BCL2-01         -----------gacaacatcgccctgtggatgactgagtacctgaaccgg
G1T264_BCL2L10-01      ----------------------------------------cctcgcaggg
G1T2Q0_MCL1-02         -----------gaaagtatc------------acagatgttctcgtcagg
G1T2Q0_MCL1-01         -----------gaaagtatc------------acagatgttctcgtcagg
G1TV33_BCL2L2-01       -----------ggacaagtgcaggagtggatggtgacctacctggagacg
Q9MYW4_BCL2L1-01       -----------agtcggatcgcggcgtggatggccacttacctgaatgac

G1T1L8_BCL2A1-01       aggatgggagaatggataaggcaaaacggaggctgggaaaatggatttgt
G1TW27_BCL2-01         cacctgcacacctggatccaggataatggaggctggg---atgccttcgt
G1T264_BCL2L10-01      cagcaccgcgcctggctgcaggctcaaggcggctggg---atggcttttg
G1T2Q0_MCL1-02         acgaaacgggactggctagtcaaacaaagaggctggg---atgggtttgt
G1T2Q0_MCL1-01         acgaaacgggactggctagtcaaacaaagaggctggg---atgggtttgt
G1TV33_BCL2L2-01       cagctggccggctggatccacagcaccgggggctggg---cggagttcac
Q9MYW4_BCL2L1-01       cacctggagccctggatccaggagaacggcggctggg---acacgtttgt
                                   *** *           * *******        **   

G1T1L8_BCL2A1-01       aaa-------gaagtttgaacataattctggttggaagatttttctggaa
G1TW27_BCL2-01         ggaactgtacggccccagcgtgc------------ggcctctgtcagact
G1T264_BCL2L10-01      tgtcttctaccggactcccttaccg--------ctgaccttctggagaag
G1T2Q0_MCL1-02         ggagtt--------cttccatgtag--------aggacct-----agaaa
G1T2Q0_MCL1-01         ggagtt--------cttccatgtag--------aggacct-----agaaa
G1TV33_BCL2L2-01       agctctgtacggggatcgggccctggaggaggcgcggcgtctgcgggagg
Q9MYW4_BCL2L1-01       ggaactctacggcaacaacgcagcagccgaga-gccgcaagggccaggag

G1T1L8_BCL2A1-01       gttgcaaaacagatctgtgt----gatactgt----------cgttgctg
G1TW27_BCL2-01         tctcctgggtgtctctgaagactttgttcagcctgg------ccctg--a
G1T264_BCL2L10-01      actgctgg-----tccgcac----ttttctgtcctg------ctttgtag
G1T2Q0_MCL1-02         gcggc--a-----tcagaaa----tgtgctgctggc------ttttgcgg
G1T2Q0_MCL1-01         gcggc--a-----tcagaaa----tgtgctgctggc------ttttgcgg
G1TV33_BCL2L2-01       ggacctgggcg--tcagtgaggacagtgctgacggg---ggccgtggcac
Q9MYW4_BCL2L1-01       cgcttcaaccg--ctggt--------tcctgacgggcatgaccgtggctg
                                       *         * * *               *   

G1T1L8_BCL2A1-01       aagaagtactgctga------------------------------
G1TW27_BCL2-01         taggagcttgcatcaccctcggtgcctacctgggccacaagtga-
G1T264_BCL2L10-01      ctacagccttactcttcgcctggacgcgcgtgtat----------
G1T2Q0_MCL1-02         gtgttgccggagtaggag-cggggctggcttatctgataaga---
G1T2Q0_MCL1-01         gtgttgccggagtaggag-cggggctggcttatctgataagatag
G1TV33_BCL2L2-01       tgggggccctggtaactgtaggggccttttttgctagcaaatga-
Q9MYW4_BCL2L1-01       gcgtggttctg------ctgggctccctcttcagccggaaatga-

© 1998-2019