Dataset for CDS BCL-2 of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1TW27_BCL2-01      atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccac
G1TW27_BCL2-02      atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccac
                    ************************************************************

G1TW27_BCL2-01      tataagctgtcccagaggggctacgagtgggacgctggggacgcgggcgccgcctccgcg
G1TW27_BCL2-02      tataagctgtcccagaggggctacgagtgggacgctggggacgcgggcgccgcctccgcg
                    ************************************************************

G1TW27_BCL2-01      ccgggcgtcttctcctcccagcccgcgcccgctgcgccccgggacccggccgccaggacc
G1TW27_BCL2-02      ccgggcgtcttctcctcccagcccgcgcccgctgcgccccgggacccggccgccaggacc
                    ************************************************************

G1TW27_BCL2-01      tcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
G1TW27_BCL2-02      tcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
                    ************************************************************

G1TW27_BCL2-01      cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcg
G1TW27_BCL2-02      cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcg
                    ************************************************************

G1TW27_BCL2-01      gagatgtccagccagctgcacctgacgccctttcacgcgagggggcgctttgccacggtg
G1TW27_BCL2-02      gagatgtccagccagctgcacctgacgccctttcacgcgagggggcgctttgccacggtg
                    ************************************************************

G1TW27_BCL2-01      gtggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttc
G1TW27_BCL2-02      gtggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttc
                    ************************************************************

G1TW27_BCL2-01      ggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
G1TW27_BCL2-02      ggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
                    ************************************************************

G1TW27_BCL2-01      gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatgga
G1TW27_BCL2-02      gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatgga
                    ************************************************************

G1TW27_BCL2-01      ggct-------------------------gggatgccttcg-------------------
G1TW27_BCL2-02      ggctgggcagacaaaagcccttggatctcggggtgtctttgtacttctcggagagccacc
                    ****                         *** ** *** *                   

G1TW27_BCL2-01      ------------------------------------------------------------
G1TW27_BCL2-02      ccaggagcacattccctgacggagggctcagccacctcttccgcctcattatactctgct
                                                                                

G1TW27_BCL2-01      ------------------------------tggaa----------------------ctg
G1TW27_BCL2-02      cagcaccgagaagcctggcatggtttctgctggaatgaaaagattggcagagctgcccta
                                                  *****                      ** 

G1TW27_BCL2-01      tacggccccagcg-----------------------------------------------
G1TW27_BCL2-02      gacaacagcaccgcaaaacactgtggcagaaggtttggtctacataccaaggcagccaaa
                     **  *  ** **                                               

G1TW27_BCL2-01      --------tgcggcctctgt----------------------------------------
G1TW27_BCL2-02      gtattaattgcattctctgtgatcgcaaaaaaggcgctgaattcttctcttcacgttttc
                            ***   ******                                        

G1TW27_BCL2-01      -------cagacttctcct-----------------------------------------
G1TW27_BCL2-02      agaatgacagacttctgctctgccagctctgagcacagcgcatcacatggaaaggagcgg
                           ********* **                                         

G1TW27_BCL2-01      ------------------------------------------------------------
G1TW27_BCL2-02      ctagatttgagggggaaaactcagaagacggatgatggtagccagctagttcttcaaaaa
                                                                                

G1TW27_BCL2-01      --------------------------------------------------gggtg-----
G1TW27_BCL2-02      gagttccccgtgaactgtttcggaactgtggaaggtcagaagcagagtaaggatgtactt
                                                                      ** **     

G1TW27_BCL2-01      ----------------tctctgaagactttgttca-------------------------
G1TW27_BCL2-02      ccatgcatttacataatctacgaagccttttcccatcttgaagtcttactttatgtgttg
                                    ***  **** ****   **                         

G1TW27_BCL2-01      -------gcctggcc--ctgatag---------gagc----------ttgcatcaccctc
G1TW27_BCL2-02      cagtgggacctggccagctgccagctgcagtttgagcccatttccttttgcattggtttc
                            *******  ***  **         ****          ******     **

G1TW27_BCL2-01      ggtgcct------acctgggccacaagtga
G1TW27_BCL2-02      tgtgtccagggaaaccttgtttctctatga
                     *** *       **** *        ***

© 1998-2019