Dataset for CDS BCL-2-like of organism Ornithorhynchus anatinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6S8G3_BCL2A1-01      atg----gacgacggtgtattctggtc----------cgtccgagccctg
F7G6M3_BCL2L2-01      atgccaagtgcccggaattctcccctcccccgccagtcggccgcccctca
                      ***    *    ***  *  **   **          ** ***  **   

F6S8G3_BCL2A1-01      gctctggactatctggat----------------------gacgtcctcc
F7G6M3_BCL2L2-01      gccctg--ctgtcttgccccctgcccctccaggccccccggcagccctcc
                      ** ***  ** *** *                        *  * *****

F6S8G3_BCL2A1-01      agacgcc-------------------------------------------
F7G6M3_BCL2L2-01      tgacgcccctccacggcctccccctccccgctgtcctgcagccccccgga
                       ******                                           

F6S8G3_BCL2A1-01      --gcgacttggga--------cggtcccaagca----------------g
F7G6M3_BCL2L2-01      tggcgaccccggccccggcctcggtctcagacacccgggccctggtggcg
                        *****   **         ***** **  **                *

F6S8G3_BCL2A1-01      aacttctcgggc--------gctgcaaaacgtcatgttct----------
F7G6M3_BCL2L2-01      gactttgtgggctacaagctgcggcagaagggcttcgcctgcggggccgg
                       ****   ****        ** *** ** * * *   **          

F6S8G3_BCL2A1-01      -----------------cggtcca------------------gggggacg
F7G6M3_BCL2L2-01      gcccggggagggccccccggcccagcccctgcaccgggccatgcgggccg
                                       *** ***                  * *** **

F6S8G3_BCL2A1-01      tggagaaggctctgaagccgtgcttc-----gacagtctcgacgttggct
F7G6M3_BCL2L2-01      ccggggacgagttcgagtcacgcttccggcgggccttctcggacttggcg
                        * * * *   *  ** *  *****     * *  *****   ***** 

F6S8G3_BCL2A1-01      ----------------cggtaggggcagccagaagaatcttcggccaaat
F7G6M3_BCL2L2-01      tcccagctgcacgtgacgcccggctcggcccagcagcgcttcacccaggt
                                      **   **  * ***        ****  ***  *

F6S8G3_BCL2A1-01      tgtggaaaaggagttcgaggacggcatcgtcaactgggggcggattgtga
F7G6M3_BCL2L2-01      gtcggacgagctcttccagggggggc---ccaactggggccggctggtgg
                         ***  **   *** ***  **      ********* *** * *** 

F6S8G3_BCL2A1-01      cgatatttgtcttggggg--gcattct-caccaagaagctc--caaagga
F7G6M3_BCL2L2-01      ccttcttcgtgttcggggccgcgctctgcgccgagagcgtcaacaaggag
                      *  * ** ** ** ****  **  *** * ** ***   **  *** *  

F6S8G3_BCL2A1-01      gcggagtcccgctgacgagagagactcggga---ggagatttcttgtttc
F7G6M3_BCL2L2-01      atggagccc--ctggtggggcaggtgcaggactggatggtggcctacctg
                        **** **  ***  * *  **   * ***   *  * *  * *   * 

F6S8G3_BCL2A1-01      atcgcggagttcacc------acccaccacgccggagagtggataaggc-
F7G6M3_BCL2L2-01      gacacccagctggccgactggatccgcagcagcgggggctgggcggagtt
                        * *  ** *  **      * ** *  *  *** *  ***     *  

F6S8G3_BCL2A1-01      --------------agaacggaggctgggaaaatg---gatttttaaata
F7G6M3_BCL2L2-01      cacggccctgtacggggacggggccctggaggacgcccggcgcctgcggg
                                     * **** * *  ***  * *   *     *     

F6S8G3_BCL2A1-01      agtttgaacaaaagaccgtctggtcggtgttagcgga---tatttcgatg
F7G6M3_BCL2L2-01      agggcaactgggcctccgtccggaccgtgctgacgggggccgtggcgctg
                      **    *        ***** ** * *** *  ***      *  ** **

F6S8G3_BCL2A1-01      aagatcttg------ggcgtactctcccacctgaagcaattttactga
F7G6M3_BCL2L2-01      ggagccctggtgaccgtcggggccttcttcgcgagcaaa------tga
                           * **      * **    ** *  *  **   **      ***

© 1998-2018