Dataset for CDS MCL-1 of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I3JHR5_MCL1-01      atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcct
I3KXG5_MCL1-01      ------------------------------------------------------------

I3JHR5_MCL1-01      caaaatggagtcctggagggaccaatgcactatggatcggggaaatcctctccgcagaat
I3KXG5_MCL1-01      ------------------------------------------------------------

I3JHR5_MCL1-01      gccacaggctcctctaaagactctagcaacgggattgtgtctaatggtacccccaaacgg
I3KXG5_MCL1-01      ------------------------------------------------------------

I3JHR5_MCL1-01      ccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
I3KXG5_MCL1-01      ------------------------------------------------------------

I3JHR5_MCL1-01      gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgag
I3KXG5_MCL1-01      ------------------------------------------------------------

I3JHR5_MCL1-01      gagctggagagagaaacgaaactccttattcacagttttttgggtgattttactggactt
I3KXG5_MCL1-01      ---ctggagagagaaactaaactcattattcacagttttttgggagactttactggactt
                       ************** ****** ******************* ** ************

I3JHR5_MCL1-01      tctcagcctcaacgaaaggaaaccaaagcactaaaaacgatgaaaagagttgttgcggac
I3KXG5_MCL1-01      tctcagcctcaacgaaaggaaaccaaagcactaaaaatgatgaaaagagttgttgcggac
                    ************************************* **********************

I3JHR5_MCL1-01      gtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
I3KXG5_MCL1-01      gtattagaaaagcacagatatgcttacaacggaatgattaataaattgtcattggatgaa
                    ******************** ************************ **************

I3JHR5_MCL1-01      agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacg
I3KXG5_MCL1-01      agagaagaagatatgtcatt---------tgtagcgaagagcctctttggagaccacacg
                    *** * ** ***********         ******************** **********

I3JHR5_MCL1-01      accaactggggtcgtattgtcagctttgtggccttcggagcagtggtgtctcagcacctg
I3KXG5_MCL1-01      accaactggggtcgtattgtcagctttgtggccttcggggcagtggtgtctcagcacctg
                    ************************************** *********************

I3JHR5_MCL1-01      aaggaaaagggcagagacaactgcgtggcgctagtgagccaagaggtttctgcatacctg
I3KXG5_MCL1-01      aaggaaaagggcagggacaactgcgtggtgctagtgagtcaagagatttctgcatacttg
                    ************** ************* ********* ****** *********** **

I3JHR5_MCL1-01      ctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
I3KXG5_MCL1-01      ctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttgtggcgttc
                    ************************ ****************************** ****

I3JHR5_MCL1-01      tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggattt
I3KXG5_MCL1-01      gttcgagtagcagaccctgagtcgatagtcaggaacacactcatggcctttgctggattt
                     ********************** *  *********************************

I3JHR5_MCL1-01      gctggtattggggcaacactggccctgttgatcaggttctgggatgcattattgtga
I3KXG5_MCL1-01      gcttgtattggggcaacactggcactgttgatcag------------------gtga
                    *** ******************* ***********                  ****

© 1998-2019