Dataset for CDS BCL-2-like of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I3IZK7_BCL2L1-01       ---------tacaaaatgtctcaaaa------------------------
I3J363_BCL2L10-01      ---------------atgtcgagagg------------------------
I3JHR5_MCL1-01         atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagacta
I3KXG5_MCL1-01         --------------------------------------------------

I3IZK7_BCL2L1-01       -----------------------cagag-aactggtgcttttctacataa
I3J363_BCL2L10-01      -----------------------cggagtcacacattctctatcagctga
I3JHR5_MCL1-01         tcttcttcctcaaaatggagtcctggagggaccaatgcactatggatcgg
I3KXG5_MCL1-01         --------------------------------------------------

I3IZK7_BCL2L1-01       ggtat---------------------------------------------
I3J363_BCL2L10-01      aggga---------------------------------------------
I3JHR5_MCL1-01         ggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaac
I3KXG5_MCL1-01         --------------------------------------------------

I3IZK7_BCL2L1-01       aaactctcccagagaaactatcctc-tcaaccacata-------------
I3J363_BCL2L10-01      agactcaactgtaccgacgctctccttccgccgtct--------------
I3JHR5_MCL1-01         gggattgtgtctaatggtacccccaaacggccgaacaacctcggggtaac
I3KXG5_MCL1-01         --------------------------------------------------

I3IZK7_BCL2L1-01       --------------gtactcaacgagcctttgaacaggactgatgggggg
I3J363_BCL2L10-01      ------------gtatgtgcagagagcagtc---tgatatcgctgggagg
I3JHR5_MCL1-01         ctcaacaaacgggtatacaacaaaagctatc---cgggaccgggaggaag
I3KXG5_MCL1-01         --------------------------------------------------

I3IZK7_BCL2L1-01       gcggcggggtt-----------------------------------ggat
I3J363_BCL2L10-01      aaaatgaaattctg------------------------------------
I3JHR5_MCL1-01         acggttcgttgccgagcaccccggagtatcatttggacggtgaatccgac
I3KXG5_MCL1-01         --------------------------------------------------

I3IZK7_BCL2L1-01       gaggaacagcgaatagacac-----------------acacgccaatggg
I3J363_BCL2L10-01      --tgggctgtggaaagagaccctgcttttggccgaggactacctgtcc--
I3JHR5_MCL1-01         gaggagctggagagagaaac--------------gaaactccttattcac
I3KXG5_MCL1-01         ------ctggagagagaaac--------------taaactcattattcac
                             * *   * *** **                 **           

I3IZK7_BCL2L1-01       acttttaatggcacgagtccc--gggacccctccggcatccccgcagcgg
I3J363_BCL2L10-01      -ttttg--ctgcacgagtccacatcaagcccctccacctcccagcga---
I3JHR5_MCL1-01         agtttt--ttgggtgattttac-tggactttctcagcctcaacgaaa---
I3KXG5_MCL1-01         agtttt--ttgggagactttac-tggactttctcagcctcaacgaaa---
                         ***     *   ** *        *      *  * **   *      

I3IZK7_BCL2L1-01       cagcagcagccgccatcaacgacggacctcgacgcagtgaaggaggcgct
I3J363_BCL2L10-01      --------------atcagccgctgcc---------atgaggcgtctggg
I3JHR5_MCL1-01         --------------ggaaaccaaagcactaaaaacgatgaaaagagttgt
I3KXG5_MCL1-01         --------------ggaaaccaaagcactaaaaatgatgaaaagagttgt
                                        * *    *            ***          

I3IZK7_BCL2L1-01       ccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagc-
I3J363_BCL2L10-01      ctgggacat---------cgaaagacagcaccaagctcgcttcgacaacc
I3JHR5_MCL1-01         tgcggacgt---------attagaaaagca-cagatacgctt--acaac-
I3KXG5_MCL1-01         tgcggacgt---------attagaaaagca-cagatatgctt--acaac-
                          ****                    **   *     *      ** * 

I3IZK7_BCL2L1-01       -------gaccttcacagccagctgca--------catcacgccggccac
I3J363_BCL2L10-01      tcgctcagaccttcctggtgcagtgtgggccggaccactgcctcagcctc
I3JHR5_MCL1-01         -------ggaatgattaataaactgt---------cattggatgaaagac
I3KXG5_MCL1-01         -------ggaatgattaataaattgt---------cattggatgaaagag
                              *   *           **          **             

I3IZK7_BCL2L1-01       ggcctaccaaagctttgagaac----------gtgatggacgaggtgttc
I3J363_BCL2L10-01      ag------aaag--------------------gtgatgaaggagctggtt
I3JHR5_MCL1-01         ac------gaggatatgtcatttgtcggtgctgtagcgaagagcctcttt
I3KXG5_MCL1-01         aa------gaagatatgtcatt---------tgtagcgaagagcctcttt
                                * *                    **   * *     *  * 

I3IZK7_BCL2L1-01       cgggacggc------gtcaactggggccgcatcgtagggctttttgcgtt
I3J363_BCL2L10-01      ggagatggacacttg---aactgggggagggttgtttctctttttgcctt
I3JHR5_MCL1-01         gcagac---cacacgaccaactggggtcgtattgtcagctttgtggcctt
I3KXG5_MCL1-01         ggagac---cacacgaccaactggggtcgtattgtcagctttgtggcctt
                          **             ********  *  * **     ** * ** **

I3IZK7_BCL2L1-01       cgg-----------------------cggggcac----------tgtgtg
I3J363_BCL2L10-01      tactggagtgctggccagaaagatcctggagcagaagccggggctggacc
I3JHR5_MCL1-01         --------------------------cggagcag----------tggtgt
I3KXG5_MCL1-01         --------------------------cggggcag----------tggtgt
                                                  ** ***           **    

I3IZK7_BCL2L1-01       ttgagtgcgtcgagaa----ggagatgagccccttggtgg--gcaggatc
I3J363_BCL2L10-01      ctgggcaacagcaggaactgggacaggagcccatgagctgcagaaggctg
I3JHR5_MCL1-01         ctcagcacctgaaggaaaaggg-cagagac-----aactgcgtggcgcta
I3KXG5_MCL1-01         ctcagcacctgaaggaaaaggg-cagggac-----aactgcgtggtgcta
                        *  *       ** *    **  *    *         *      * * 

I3IZK7_BCL2L1-01       gtagagtggatga----ccgtctacctagacaaccacattcagccctgga
I3J363_BCL2L10-01      gcagagaccatag----ctgattacctgggagaagagaagaaagactggc
I3JHR5_MCL1-01         gt-gagccaagaggtttctgcatacctgctgtctgaacagcgagactgga
I3KXG5_MCL1-01         gt-gagtcaagagatttctgcatacttgctgtctgaacagcgagactgga
                       *  ***   *       * *  *** *        *         **** 

I3IZK7_BCL2L1-01       tccagagccaaggaggatgggagcgcttcgctgaaatcttcgggcaggat
I3J363_BCL2L10-01      tgttggataatgatggatgggaaggcttctgtaagttctcc---cgcagt
I3JHR5_MCL1-01         ttgtcaaaaacaatgcatgggatggctttgtggagttcttt---c-----
I3KXG5_MCL1-01         ttatcaaaaacaatgcatgggatggctttgtggcgttcgtt---c-----
                       *        *    * ******  ****        **      *     

I3IZK7_BCL2L1-01       gcggcggctgaaagccggaggtc-----tcaggagagtttcaagaagtgg
I3J363_BCL2L10-01      gccagagaagtgagccaggactcatccatgaagaaagcgctgt----ttg
I3JHR5_MCL1-01         ----gagtagcagaccctgagtccacggtcaggaacacactca----tgg
I3KXG5_MCL1-01         ----gagtagcagaccctgagtcgatagtcaggaacacactca----tgg
                             *  *    **     **     * * **             * *

I3IZK7_BCL2L1-01       ctgctggtggggatgacggtggtgacgggcgttgtggctggtgct---ct
I3J363_BCL2L10-01      ctgccgccggtgtcggccttgctg-----------ggcttacctt---cc
I3JHR5_MCL1-01         cctttgctggatttgctggtattg-----------gggcaacactggccc
I3KXG5_MCL1-01         cctttgctggatttgcttgtattg-----------gggcaacactggcac
                       *    *  **    *    *  **           **       *     

I3IZK7_BCL2L1-01       tatcgcgcaa------aaacgcc----tgtga
I3J363_BCL2L10-01      tcttggtcaa------aggcttcagattttga
I3JHR5_MCL1-01         tgttgatcaggttctgggatgcattattgtga
I3KXG5_MCL1-01         tgttgatcag------------------gtga
                       * * *  **                    ***

© 1998-2019