Dataset for CDS BCL-2-like of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3HNF3_BCL2A1-      atgacagac-----tgcgaatttgga-tatatttacagg---ctagctca
A0A2I3HNF3_BCL2A1-      atgacagac-----tgcgaatttgga-tatatttacagg---ctagctca
A0A2I3HNF3_BCL2A1-      atgacagac-----tgcgaatttgga-tatatttacagg---ctagctca
A0A2I3GZF9_BCL2-01      atggcgcac---gctgggagaacagggtacgataaccgggagatagtgat
G1RER8_BCL2L1-01        at----------------gtctcagagcaa-----ccgggagctggtggt
G1RYB4_BCL2L2-03        atggcgaccccagcctcggccccaga-cac-----acgggctctggtggc
G1RYB4_BCL2L2-01        atggcgaccccagcctcggccccaga-cac-----acgggctctggtggc
G1R3W6_BCL2L10-01       atggttgac-cagttgcgggagcgcaccga-----gcggctgctggccga
A0A2I3GB35_MCL1-01      atgtttggc-c-tcagaagaaacgcggtaa-----tcgg--actcaacct
A0A2I3GB35_MCL1-03      atgtttggc-c-tcagaagaaacgcggtaa-----tcgg--actcaacct
A0A2I3GB35_MCL1-02      atgtttggc-c-tcagaagaaacgcggtaa-----tcgg--actcaacct
                        **                                   **    *      

A0A2I3HNF3_BCL2A1-      ggactatctgcagtac-----gtcctacagataccacagcct--------
A0A2I3HNF3_BCL2A1-      ggactatctgcagtac-----gtcctacagataccacagcct--------
A0A2I3HNF3_BCL2A1-      ggactatctgcagtac-----gtcctacagataccacagcct--------
A0A2I3GZF9_BCL2-01      gaagtacatccattataagctgtcgcagaggggctacgagtg--------
G1RER8_BCL2L1-01        tgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
G1RYB4_BCL2L2-03        agactttgtaggttataagctgaggcagaagggttatgtctg--------
G1RYB4_BCL2L2-01        agactttgtaggttataagctgaggcagaagggttatgtctg--------
G1R3W6_BCL2L10-01       ctacctgg---------------------ggtgctgcgcccg--------
A0A2I3GB35_MCL1-01      ctactgtg---------------------ggggggccggctt--------
A0A2I3GB35_MCL1-03      ctactgtg---------------------ggggggccggctt--------
A0A2I3GB35_MCL1-02      ctactgtg---------------------ggggggccggctt--------

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      ----ggatgcgggagatgtgggcgccgcgcccccgg--gggccgcccccg
G1RER8_BCL2L1-01        ttagtgatgtggaagagaacaggactgaggccccagaagggactgaatcg
G1RYB4_BCL2L2-03        --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
G1R3W6_BCL2L10-01       -------------------ggaacccggcacccccgagccgacgccgtcc
A0A2I3GB35_MCL1-01      -------------------gggggccggca-----gcggcggcgccaccc
A0A2I3GB35_MCL1-03      -------------------gggggccggca-----gcggc----------
A0A2I3GB35_MCL1-02      -------------------gggggccggca-----gcggcggcgccaccc

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      caccgggcatcttctcctcccagccggggcacacgccccatccagctgca
G1RER8_BCL2L1-01        gagatggagacccccagtgccatcaatggcaacc--------------ca
G1RYB4_BCL2L2-03        ----tggag-----------------------------------------
G1RYB4_BCL2L2-01        ----tggag-----------------------------------------
G1R3W6_BCL2L10-01       acgcccgaggccgccatg------------------------------ct
A0A2I3GB35_MCL1-01      ctccgggagggcggcttt------------------------------tg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      ctccgggagggcggcttt------------------------------tg

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      tcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccc
G1RER8_BCL2L1-01        tcctggcacctggcggacag--ccccgcggtgaatggagccactggccac
G1RYB4_BCL2L2-03        --ctggccccggg-------------------------------------
G1RYB4_BCL2L2-01        --ctggccccggg-------------------------------------
G1R3W6_BCL2L10-01       gc-------------------gctccgcggccgccagg------------
A0A2I3GB35_MCL1-01      gctacggagaaggaggcctcggcccggcgagagatagggggaggggaggc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      gctacggagaaggaggcctcggcccggcgagagatagggggaggggaggc

A0A2I3HNF3_BCL2A1-      ------------ggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2I3HNF3_BCL2A1-      ------------ggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2I3HNF3_BCL2A1-      ------------ggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2I3GZF9_BCL2-01      cggcgcc-----gccgcggggcctg--cgctcagcccggtgccacctgtg
G1RER8_BCL2L1-01        agcagca-----gtttggatgcccgggaggtgatccccatggcagcagta
G1RYB4_BCL2L2-03        ----------------gagggcccagcagctgacccgc----------tg
G1RYB4_BCL2L2-01        ----------------gagggcccagcagctgacccgc----------tg
G1R3W6_BCL2L10-01       ------------ttacggcagctc---cacccgtccttcttctccgccta
A0A2I3GB35_MCL1-01      cggcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctca
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      cggcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctca

A0A2I3HNF3_BCL2A1-      ---cgttgcgttctcagtccaaaaagaag-----------tggaaaagaa
A0A2I3HNF3_BCL2A1-      ---cgttgcgttctcagtccaaaaagaag-----------tggaaaagaa
A0A2I3HNF3_BCL2A1-      ---cgttgcgttctcagtccaaaaagaag-----------tggaaaagaa
A0A2I3GZF9_BCL2-01      gtccacctgaccctccgccaggc-----------------cggcgatgac
G1RER8_BCL2L1-01        ---aagcaagcgctgagggaggc-----------------aggcgacgag
G1RYB4_BCL2L2-03        ---caccaagccatgcgggcagc-----------------tggagatgag
G1RYB4_BCL2L2-01        ---caccaagccatgcgggcagc-----------------tggagatgag
G1R3W6_BCL2L10-01       ---cctcggctaccctgggaaccgcgt-----cgagctggtggtgctgat
A0A2I3GB35_MCL1-01      ---caccagactcccggagggtcgcgcggccgccgcccattggcgccgag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      ---caccagactcccggagggtcgcgcggccgccgcccattggcgccgag

A0A2I3HNF3_BCL2A1-      -------------tctgaagccgtgcttgg-acaatgttaatgttgtgtc
A0A2I3HNF3_BCL2A1-      -------------tctgaagccgtgcttgg-acaatgttaatgttgtgtc
A0A2I3HNF3_BCL2A1-      -------------tctgaagccgtgcttgg-acaatgttaatgttgtgtc
A0A2I3GZF9_BCL2-01      ------------ttctcccgccgctaccgccgcgacttcgccgagatgtc
G1RER8_BCL2L1-01        ------------tttgaactgcggtaccggcgggcattcagtgacctgac
G1RYB4_BCL2L2-03        ------------ttcgagacccgcttccggcgcaccttctctgatctggc
G1RYB4_BCL2L2-01        ------------ttcgagacccgcttccggcgcaccttctctgatctggc
G1R3W6_BCL2L10-01       ----------------------------ggcggattccgtgctctccgac
A0A2I3GB35_MCL1-01      gtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccac
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      gtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccac

A0A2I3HNF3_BCL2A1-      catagacactgc----------------------cagaacactat-----
A0A2I3HNF3_BCL2A1-      catagacactgc----------------------cagaacactat-----
A0A2I3HNF3_BCL2A1-      catagacactgc----------------------cagaacactat-----
A0A2I3GZF9_BCL2-01      cagc----cagctgcacctgacgcccttca----ccgcgcggggacgct-
G1RER8_BCL2L1-01        atcc----cagctccacatcaccccaggga----cagcatatcagagct-
G1RYB4_BCL2L2-03        ggct----cagctgcatgtgaccccaggct----cagcccaacaacgct-
G1RYB4_BCL2L2-01        ggct----cagctgcatgtgaccccaggct----cagcccaacaacgct-
G1R3W6_BCL2L10-01       agccc---cggccccacctgggg-----------cagagtggtgacgc--
A0A2I3GB35_MCL1-01      ccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgcca
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      ccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgcca

A0A2I3HNF3_BCL2A1-      tcaaccaagtgatggaaaaggag--------------------tttgaag
A0A2I3HNF3_BCL2A1-      tcaaccaagtgatggaaaaggag--------------------tttgaag
A0A2I3HNF3_BCL2A1-      tcaaccaagtgatggaaaaggag--------------------tttgaag
A0A2I3GZF9_BCL2-01      ttgccacggtggtggaggagctc--------------------ttcaggg
G1RER8_BCL2L1-01        ttgaacaggtagtgaatgaactc--------------------ttccggg
G1RYB4_BCL2L2-03        tcacccaggtctccgatgaactt--------------------tttcaag
G1RYB4_BCL2L2-01        tcacccaggtctccgatgaactt--------------------tttcaag
G1R3W6_BCL2L10-01       tcgtggccttcgcagggacgctg----------------------ctgga
A0A2I3GB35_MCL1-01      tcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcggg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      tcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcggg

A0A2I3HNF3_BCL2A1-      atggcatcattaactgg-ggaagaattgtaaccatatttgca--------
A0A2I3HNF3_BCL2A1-      atggcatcattaactgg-ggaagaattgtaaccatatttgca--------
A0A2I3HNF3_BCL2A1-      atggcatcattaactgg-ggaagaattgtaaccatatttgca--------
A0A2I3GZF9_BCL2-01      acggggtg---aactgg-gggaggattgtggccttctttgag--------
G1RER8_BCL2L1-01        atggggta---aactgg-ggtcgcattgtggcctttttctcc--------
G1RYB4_BCL2L2-03        ggggcccc---aactgg-ggccgccttgtagccttctttgtc--------
G1RYB4_BCL2L2-01        ggggcccc---aactgg-ggccgccttgtagccttctttgtc--------
G1R3W6_BCL2L10-01       gagagggc---cgctggtgaccgcccggtggaagaagtgggg--------
A0A2I3GB35_MCL1-01      aagcggcc---ggctgtcctgcccctgctggagttggtcggggaatctgg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      aagcggcc---ggctgtcctgcccctgctggagttggtcggggaatctgg

A0A2I3HNF3_BCL2A1-      ------------------------------tttgaaggtattctc-----
A0A2I3HNF3_BCL2A1-      ------------------------------tttgaaggtattctc-----
A0A2I3HNF3_BCL2A1-      ------------------------------tttgaaggtattctc-----
A0A2I3GZF9_BCL2-01      ------------------------------ttcggtggggtcat------
G1RER8_BCL2L1-01        ------------------------------ttcggcggggcact------
G1RYB4_BCL2L2-03        ------------------------------tttggggctgcact------
G1RYB4_BCL2L2-01        ------------------------------tttggggctgcact------
G1R3W6_BCL2L10-01       ------------------------------cttccagccgcggctaaagg
A0A2I3GB35_MCL1-01      taataacaccagtacggacgggtcactaccctcgacgccgccgccagcag
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      taataacaccagtacggacgggtcactaccctcgacgccgccgccagcag

A0A2I3HNF3_BCL2A1-      -gtcaagaaacttctacgacagcgaactgccccggatgtggatacttaca
A0A2I3HNF3_BCL2A1-      -gtcaagaaacttctacgacagcgaactgccccggatgtggatacttaca
A0A2I3HNF3_BCL2A1-      -gtcaagaaacttctacgacagcgaactgccccggatgtggatacttaca
A0A2I3GZF9_BCL2-01      -gtgtgtggagagcgtcaaccgggagatgtcgcccctggtggaca-----
G1RER8_BCL2L1-01        -gtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtc-----
G1RYB4_BCL2L2-03        -gtgtgctgagagtgtcaacaaggagatggaaccactggtgggac-----
G1RYB4_BCL2L2-01        -gtgtgctgagagtgtcaacaaggagatggaaccactggtgggac-----
G1R3W6_BCL2L10-01       agcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgct-
A0A2I3GB35_MCL1-01      aggaggaggagga---cgagttgtaccggcagtcgctggagatcatctc-
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      aggaggaggagga---cgagttgtaccggcagtcgctggagatcatctc-

A0A2I3HNF3_BCL2A1-      aggagatttcgtattttgttgcagagttcataatgaataacacaggagaa
A0A2I3HNF3_BCL2A1-      aggagatttcgtattttgttgcagagttcataatgaataacacaggagaa
A0A2I3HNF3_BCL2A1-      aggagatttcgtattttgttgcagagttcataatgaataacacaggagaa
A0A2I3GZF9_BCL2-01      ---acatcgccctgtggatgactgagtacctgaaccggcacctgcacacc
G1RER8_BCL2L1-01        ---ggattgcagcttggatggccacttacctgaatgaccacctagagcct
G1RYB4_BCL2L2-03        ---aagtgcaggagtggatggtggcctacttggagacgcggctggctgac
G1RYB4_BCL2L2-01        ---aagtgcaggagtggatggtggcctacttggagacgcggctggctgac
G1R3W6_BCL2L10-01       --gagctcgcgcctcgtggggcag-----------------caccgcgcc
A0A2I3GB35_MCL1-01      --tcg---gtaccttcgggagcaggccaccggcgccaaggacacaaagcc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      --tcg---gtaccttcgggagcaggccaccggcgccaaggacacaaagcc

A0A2I3HNF3_BCL2A1-      tggataaggcaaaacggaggctggggg--aaatggc-------ataatca
A0A2I3HNF3_BCL2A1-      tggataaggcaaaacggaggct-ggga--aaatggctttgtaaagaagtt
A0A2I3HNF3_BCL2A1-      tggataaggcaaaacggaggct-ggga--aaatggctttgtaaagaagtt
A0A2I3GZF9_BCL2-01      tggatccaggataacggaggctgggat------gcctttgtggaactgta
G1RER8_BCL2L1-01        tggatccaggagaacggcggctgggat------acttttgtggaactcta
G1RYB4_BCL2L2-03        tggatccacagcagtgggggctgggcg------gagttcacagctctata
G1RYB4_BCL2L2-01        tggatccacagcagtgggggctgggagctggaagctatcaaagctcgagt
G1R3W6_BCL2L10-01       tggctgcaggctcagggcggctgggtg--------------agcacgcgg
A0A2I3GB35_MCL1-01      aatgggcaggtctggggccacc-agca--------------ggaaggcgc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      aatgggcaggtctggggccacc-agca--------------ggaaggcgc

A0A2I3HNF3_BCL2A1-      catgcctatg-c-------------tggtagagtcagtggcccacaag-a
A0A2I3HNF3_BCL2A1-      tgaacctaaatc-------------tggctggatgacttttctagaagtt
A0A2I3HNF3_BCL2A1-      tgaacctaaatc-------------tggctggatgacttttctagaagtt
A0A2I3GZF9_BCL2-01      cggccccagcat--------------------------------------
G1RER8_BCL2L1-01        tgggaacaatgc-----------------------agcagccgagagccg
G1RYB4_BCL2L2-03        cggggacggggccctgg-----------------aggaggcgcggcgtct
G1RYB4_BCL2L2-01        cagggagatgga---gg-----------------aagaagctgagaagct
G1R3W6_BCL2L10-01       cggacaccgggacacgg---------ggcgggacgggcagccgggaagcg
A0A2I3GB35_MCL1-01      tggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      tggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacg

A0A2I3HNF3_BCL2A1-      aga------------------------------------gga--------
A0A2I3HNF3_BCL2A1-      aca------------------------------------ggaaagatc--
A0A2I3HNF3_BCL2A1-      aca------------------------------------ggaaagatctc
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        aaa----------------gggcc--------------aggaa-------
G1RYB4_BCL2L2-03        gcg----------------ggag---------------gggaactgggca
G1RYB4_BCL2L2-01        aaa----------------ggagctacagaacgaggtagagaagcagatg
G1R3W6_BCL2L10-01       ccc----------------------------------acgaggccggcac
A0A2I3GB35_MCL1-01      gccttccaa-----------------------------------------
A0A2I3GB35_MCL1-03      ---------ggcatgcttcggaaactggacatcaaaaacgaagacgatgt
A0A2I3GB35_MCL1-02      gccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgt

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      -------------------------------tgtgaaat---gctctctt
A0A2I3HNF3_BCL2A1-      aatactgttgactagaaaggacactccatattgtgaaaccggcctaattt
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
G1RYB4_BCL2L2-03        tcagtgag----------gacagtgctgac--------------------
G1RYB4_BCL2L2-01        aatatgagtccacctccaggcaatgctggcccagtgatcatgtccattga
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      caaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaa
A0A2I3GB35_MCL1-02      caaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaa

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      tcctg---------------------------------------------
A0A2I3HNF3_BCL2A1-      ttctgactcttatggaaacaattgccaacacatacttctactt-------
A0A2I3GZF9_BCL2-01      ----------gcggcctctgtttgatttctcctggctgtctct-------
G1RER8_BCL2L1-01        ---------------------------------------cgct-------
G1RYB4_BCL2L2-03        ---------gggggccg-------------------tggcact-------
G1RYB4_BCL2L2-01        ggagaagatggaggctgatgcccgttccatctatgttggcaat-------
G1R3W6_BCL2L10-01       ---------ggatggcttttgtcacttcttcaggacccccttt-------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      actggggcaggattgtgactctcatttcttttggtgcctttgtggctaaa
A0A2I3GB35_MCL1-02      actggggcaggattgtgactctcatttcttttggtgcctttgtggctaaa

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
G1RYB4_BCL2L2-01        --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      cacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaag
A0A2I3GB35_MCL1-02      cacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaag

A0A2I3HNF3_BCL2A1-      ----------------------------------------------aaat
A0A2I3HNF3_BCL2A1-      ----------------------------------------------aagc
A0A2I3HNF3_BCL2A1-      ----------------------------------------taaaataaac
A0A2I3GZF9_BCL2-01      -----------------------------------------------gaa
G1RER8_BCL2L1-01        -----------------------------------------------tca
G1RYB4_BCL2L2-03        -----------------------------------------------ggg
G1RYB4_BCL2L2-01        -----------------------------------------------gtg
G1R3W6_BCL2L10-01       ------------------------------ccgctggctttttggagaaa
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      tatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaa
A0A2I3GB35_MCL1-02      tatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaa

A0A2I3HNF3_BCL2A1-      ggctttg-------------------------------------------
A0A2I3HNF3_BCL2A1-      aatactg-------------------------------------------
A0A2I3HNF3_BCL2A1-      aactttgat-----------------------------------------
A0A2I3GZF9_BCL2-01      gactctgct-----------------------------------------
G1RER8_BCL2L1-01        accgctggt-----------------------------------------
G1RYB4_BCL2L2-03        ggccctggt-----------------------------------------
G1RYB4_BCL2L2-01        gactatggtgcaacagcagaagagctggaagctcactttcatggctgtgg
G1R3W6_BCL2L10-01       acagctggt-----------------------ccaggctt------ttct
A0A2I3GB35_MCL1-01      -------gg-----------------------atgggtttgtggagttct
A0A2I3GB35_MCL1-03      gaggctggg-----------------------atgggtttgtggagttct
A0A2I3GB35_MCL1-02      gaggctggg-----------------------atgggtttgtggagttct

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      -------------------------------cagtttgg-----------
G1RER8_BCL2L1-01        --------------------------------------------------
G1RYB4_BCL2L2-03        -------------------------------aactgtaggggcctt----
G1RYB4_BCL2L2-01        ttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatccca
G1R3W6_BCL2L10-01       gtcatg--------cttgttaacaacagccttcatttat-----------
A0A2I3GB35_MCL1-01      tccatgtagaggacctagaaggtggcatcagaaatgtgc-----------
A0A2I3GB35_MCL1-03      tccatgtagaggacctagaaggtggcatcagaaatgtgc-----------
A0A2I3GB35_MCL1-02      tccatgtagaggacctagaaggtggcatcagaaatgtgc-----------

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
G1RYB4_BCL2L2-01        aagggtttgcatatatagagttctcagacaaagagtcagtgaggacttcc
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
G1RYB4_BCL2L2-01        ttggccttagatgagtccctgtttagaggaaggcaaatcaaggtgatccc
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
G1RYB4_BCL2L2-01        aaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccac
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
G1RYB4_BCL2L2-03        --------------------------------------------------
G1RYB4_BCL2L2-01        gagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcga
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------ccctggtggg--------------------agcttg
G1RER8_BCL2L1-01        --------------tcctgacgggc-------------------------
G1RYB4_BCL2L2-03        -----------ttttgctagcaag--------------------------
G1RYB4_BCL2L2-01        ttctacagtggttttaacagcaggccccggggtcgcgtctacaggggccg
G1R3W6_BCL2L10-01       --------------ttctgga---cacgattattatgagttttaaaactt
A0A2I3GB35_MCL1-01      --------------tgctggcttttgcaggtgttgctggagtaggagctg
A0A2I3GB35_MCL1-03      --------------tgctggcttttgcaggtgttgctggagtaggagctg
A0A2I3GB35_MCL1-02      --------------tgctggcttttgcaggtgttgctggagtaggagctg

A0A2I3HNF3_BCL2A1-      -------------------------------taa
A0A2I3HNF3_BCL2A1-      ------------------------------ttga
A0A2I3HNF3_BCL2A1-      ----------------------gatgtaacttga
A0A2I3GZF9_BCL2-01      catcaccctgggtgcctatctgggccacaagtga
G1RER8_BCL2L1-01        ----------------------------------
G1RYB4_BCL2L2-03        -------------------------------tga
G1RYB4_BCL2L2-01        ggctagagcgacatcatggtattccccttactaa
G1R3W6_BCL2L10-01       ttaacccgcttctacctgcacag-----ctgtga
A0A2I3GB35_MCL1-01      gtttggcatatctaataagatagccttactgtaa
A0A2I3GB35_MCL1-03      gtttggcatatctaataagatag-----------
A0A2I3GB35_MCL1-02      gtttggcatatctaataagatag-----------

© 1998-2019