Dataset for CDS BCL2L2 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1RYB4_BCL2L2-03      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
G1RYB4_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt

G1RYB4_BCL2L2-03      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
G1RYB4_BCL2L2-01      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg

G1RYB4_BCL2L2-03      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
G1RYB4_BCL2L2-01      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga

G1RYB4_BCL2L2-03      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
G1RYB4_BCL2L2-01      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca

G1RYB4_BCL2L2-03      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
G1RYB4_BCL2L2-01      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg

G1RYB4_BCL2L2-03      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
G1RYB4_BCL2L2-01      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt

G1RYB4_BCL2L2-03      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
G1RYB4_BCL2L2-01      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc

G1RYB4_BCL2L2-03      actggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
G1RYB4_BCL2L2-01      actggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc

G1RYB4_BCL2L2-03      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
G1RYB4_BCL2L2-01      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
                      ********************************* *      *   *** *

G1RYB4_BCL2L2-03      gctctatacggggacggggccctggaggaggcgcggcgtctgcgggag--
G1RYB4_BCL2L2-01      gctcgagtcagggagatgga---ggaagaagctgagaagctaaaggagct
                      **** *  * ****   **    *** ** **   *   **   ****  

G1RYB4_BCL2L2-03      -------------gggaactgggcatcagtgag----------gacagtg
G1RYB4_BCL2L2-01      acagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatg
                                   * ***   *       ****          * ** **

G1RYB4_BCL2L2-03      ctgac-----------------------------gggggccg--------
G1RYB4_BCL2L2-01      ctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgt
                      *** *                             ** *** *        

G1RYB4_BCL2L2-03      -----------tggcactgggggccctggt--------------------
G1RYB4_BCL2L2-01      tccatctatgttggcaatgtggactatggtgcaacagcagaagagctgga
                                 ***** ** ** *  ****                    

G1RYB4_BCL2L2-03      --------------------------------------------------
G1RYB4_BCL2L2-01      agctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtg

G1RYB4_BCL2L2-03      --aactgtaggggcctt---------------------------------
G1RYB4_BCL2L2-01      acaaatttagtggccatcccaaagggtttgcatatatagagttctcagac
                        ** * *** **** *                                 

G1RYB4_BCL2L2-03      --------------------------------------------------
G1RYB4_BCL2L2-01      aaagagtcagtgaggacttccttggccttagatgagtccctgtttagagg

G1RYB4_BCL2L2-03      --------------------------------------------------
G1RYB4_BCL2L2-01      aaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagca

G1RYB4_BCL2L2-03      --------------------------------------------------
G1RYB4_BCL2L2-01      caacagaccggggttttccacgagcccgctaccgcgcccggaccaccaac

G1RYB4_BCL2L2-03      --------------------------------ttttgctagcaag-----
G1RYB4_BCL2L2-01      tacaacagttcccgctctcgattctacagtggttttaacagcaggccccg
                                                      ****   **** *     

G1RYB4_BCL2L2-03      --------------------------------------------------
G1RYB4_BCL2L2-01      gggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt

G1RYB4_BCL2L2-03      --tga
G1RYB4_BCL2L2-01      actaa
                        * *

© 1998-2019