Dataset for CDS BCL2A1 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3HNF3_BCL2A1-      atgacagactgcgaatttggatatatttacaggctagctcaggactatct
A0A2I3HNF3_BCL2A1-      atgacagactgcgaatttggatatatttacaggctagctcaggactatct
A0A2I3HNF3_BCL2A1-      atgacagactgcgaatttggatatatttacaggctagctcaggactatct
                        **************************************************

A0A2I3HNF3_BCL2A1-      gcagtacgtcctacagataccacagcctggatcaggtccaagcaaaacgt
A0A2I3HNF3_BCL2A1-      gcagtacgtcctacagataccacagcctggatcaggtccaagcaaaacgt
A0A2I3HNF3_BCL2A1-      gcagtacgtcctacagataccacagcctggatcaggtccaagcaaaacgt
                        **************************************************

A0A2I3HNF3_BCL2A1-      ccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaag
A0A2I3HNF3_BCL2A1-      ccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaag
A0A2I3HNF3_BCL2A1-      ccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaag
                        **************************************************

A0A2I3HNF3_BCL2A1-      aatctgaagccgtgcttggacaatgttaatgttgtgtccatagacactgc
A0A2I3HNF3_BCL2A1-      aatctgaagccgtgcttggacaatgttaatgttgtgtccatagacactgc
A0A2I3HNF3_BCL2A1-      aatctgaagccgtgcttggacaatgttaatgttgtgtccatagacactgc
                        **************************************************

A0A2I3HNF3_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
A0A2I3HNF3_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
A0A2I3HNF3_BCL2A1-      cagaacactattcaaccaagtgatggaaaaggagtttgaagatggcatca
                        **************************************************

A0A2I3HNF3_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtc
A0A2I3HNF3_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtc
A0A2I3HNF3_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtc
                        **************************************************

A0A2I3HNF3_BCL2A1-      aagaaacttctacgacagcgaactgccccggatgtggatacttacaagga
A0A2I3HNF3_BCL2A1-      aagaaacttctacgacagcgaactgccccggatgtggatacttacaagga
A0A2I3HNF3_BCL2A1-      aagaaacttctacgacagcgaactgccccggatgtggatacttacaagga
                        **************************************************

A0A2I3HNF3_BCL2A1-      gatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
A0A2I3HNF3_BCL2A1-      gatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
A0A2I3HNF3_BCL2A1-      gatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
                        **************************************************

A0A2I3HNF3_BCL2A1-      taaggcaaaacggaggctgggggaaatggc-------ataatcacatgcc
A0A2I3HNF3_BCL2A1-      taaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
A0A2I3HNF3_BCL2A1-      taaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
                        ****************** *** *******       * **       **

A0A2I3HNF3_BCL2A1-      tatg-ctggtagagtcagtggcccacaag-aagagga-------------
A0A2I3HNF3_BCL2A1-      taaatctggctggatgacttttctagaagttacaggaaagatctcaatac
A0A2I3HNF3_BCL2A1-      taaatctggctggatgacttttctagaagttacaggaaagatc-------
                        **   ****  *  * * *   * * ***  * ****             

A0A2I3HNF3_BCL2A1-      --------------------------------------------------
A0A2I3HNF3_BCL2A1-      tgttgactagaaaggacactccatattgtgaaaccggcctaatttttctg
A0A2I3HNF3_BCL2A1-      --------------------------tgtgaaat---gctctctttcctg
                                                                          

A0A2I3HNF3_BCL2A1-      --------------------------------------------aaatgg
A0A2I3HNF3_BCL2A1-      actcttatggaaacaattgccaacacatacttctactttaaaataaacaa
A0A2I3HNF3_BCL2A1-      --------------------------------------------aagcaa
                                                                    **    

A0A2I3HNF3_BCL2A1-      ctttg-----------taa
A0A2I3HNF3_BCL2A1-      ctttgatgatgtaacttga
A0A2I3HNF3_BCL2A1-      tactg----------ttga
                           **           * *

© 1998-2018