Dataset for CDS BCL2L2 of organism Myotis lucifugus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1P3J2_BCL2L2-01      cctgaaatgctccattctgtgtctctgactaaatatactcatgccagtct
G1Q051_BCL2L2-01      ------atgaatgaattt---tctctagacaactttatgctctatagttt
                            ***    * * *   *****    ** * **  *     *** *

G1P3J2_BCL2L2-01      tttatcc-ttgacctttacagccgcccggatggc------------gacc
G1Q051_BCL2L2-01      tgattctgttgatattag-----gcccaaagtgctgggtcctaagagctc
                      *   **  ****  **       ****  *  **            *  *

G1P3J2_BCL2L2-01      ccagcctc-ggccccagacacacgggctctggtggcagactttgtaggct
G1Q051_BCL2L2-01      ccagcctcaggccccagacacacaggctctggtggcagactttgtaggct
                      ******** ************** **************************

G1P3J2_BCL2L2-01      acaagctgaggcagaagggttatgtttgtggagcgggtcccggagagggc
G1Q051_BCL2L2-01      acaagctgaggcagaagggttatgtttgtggagcgggtcccggagagggc
                      **************************************************

G1P3J2_BCL2L2-01      ccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagtt
G1Q051_BCL2L2-01      ccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtt
                      ************** ***********************************

G1P3J2_BCL2L2-01      cgagacccgtttccgtcgcaccttctctgatctggcggctcagctgcatg
G1Q051_BCL2L2-01      tgagacccatttccgatgcaccttctctgatctggtggctcagctgcatg
                       ******* ******  ****************** **************

G1P3J2_BCL2L2-01      tgaccccgggctcagcccagcaacgcttcacccaggtctctgatgaactc
G1Q051_BCL2L2-01      tgaccccaggttcagcccagcaatgtttcacccaggtctctgatgaactc
                      ******* ** ************ * ************************

G1P3J2_BCL2L2-01      ttccaagggggccccaactggggtcgccttgtggccttctttgtctttgg
G1Q051_BCL2L2-01      ttccaggggggccccaactggggttaccttgtggccttctttgtctttgg
                      ***** ******************  ************************

G1P3J2_BCL2L2-01      agctgctctgtgtgctgagagtgtcaacaaggagatggagccacttgtgg
G1Q051_BCL2L2-01      agctgctctgtgtgttgagagtgtcaacaaggagatggagccacttgtgg
                      ************** ***********************************

G1P3J2_BCL2L2-01      gacaagtacaggagtggatggtggcctacctggagacgcggctggccgac
G1Q051_BCL2L2-01      gacaagtacaggagtggacggtggcctacctggagatgcggctggctgac
                      ****************** ***************** ********* ***

G1P3J2_BCL2L2-01      tggatccacagtagtgggggctgggcggagttcacagctctatacgggga
G1Q051_BCL2L2-01      tggatccacagtattgggggctgggcagagttcacagctctatac-----
                      ************* ************ ******************     

G1P3J2_BCL2L2-01      cggggccctggaggaggctcgacgcctgcgggaggggaactgggcctcag
G1Q051_BCL2L2-01      ----------------------------------gggaactgggcctcag
                                                        ****************

G1P3J2_BCL2L2-01      tgaggacagtgctgacgggggccgtggcactaggggccttggtaactgta
G1Q051_BCL2L2-01      tgaggacagtgctgacgggggccctggcactaagggccttgttaactgta
                      *********************** ******** ******** ********

G1P3J2_BCL2L2-01      ggagcattttttgctagcaagtga
G1Q051_BCL2L2-01      ggagcattttttgctagcatgtga
                      ******************* ****

© 1998-2018