Dataset for CDS BCL-2-like of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

22 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q9Z0F3_BCL2L10-01      atggccgactcgcagg---------------acccactgcatgaacgcac
O55178_BCL2A1-01       atg----------------------------gctgagtacgagctcatgc
Q0P538_BCL2A1-01       atg----------------------------gctgagtacgagctcatgc
Q07440_BCL2A1-01       atg----------------------------gctgagtctgagctcatgc
O55179_BCL2A1-01       atg----------------------------tctgagtacgagttcatgt
Q8K164_BCL2A1-01       atg----------------------------gctgagtacgagttcatgt
Q4FK02_BCL2A1-01       atg----------------------------tctgagtacgagttcatgt
O55177_BCL2A1-02       atg----------------------------gctgagtacgagttcatgt
Q497M6_BCL2A1-01       atg----------------------------gctgagtacgagttcatgt
O35843_BCL2L1-01       atg----------------------------tctcagagc----------
Q64373_BCL2L1-09       atg----------------------------tctcagagc----------
Q64373_BCL2L1-01       atg----------------------------tctcagagc----------
Q64373_BCL2L1-03       atg----------------------------tctcagagc----------
Q64373_BCL2L1-04       atg----------------------------tctcagagc----------
P10417_BCL2-01         atg----------------------------gcgcaagccggga------
P10417_BCL2-02         atg----------------------------gcgcaagccggga------
P97287_MCL1-02         atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
P97287_MCL1-01         atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       atg------------------gcgaccccagcctcaaccccagac-----
D3Z5F7_BCL2L2-01       atg------------------gcgaccccagcctcaaccccagac-----
P70345_BCL2L2-04       atg------------------gcgaccccagcctcaaccccagac-----

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         c-------------------------------------------------
P97287_MCL1-01         cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         tggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctg
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------

Q9Z0F3_BCL2L10-01      -------------------------------------------tagacgg
O55178_BCL2A1-01       ----------------------------------------------atat
Q0P538_BCL2A1-01       ----------------------------------------------atat
Q07440_BCL2A1-01       ----------------------------------------------atat
O55179_BCL2A1-01       ----------------------------------------------atat
Q8K164_BCL2A1-01       ----------------------------------------------atat
Q4FK02_BCL2A1-01       ----------------------------------------------atat
O55177_BCL2A1-02       ----------------------------------------------atat
Q497M6_BCL2A1-01       ----------------------------------------------atat
O35843_BCL2L1-01       ----------------------------------aaccgggagctggtgg
Q64373_BCL2L1-09       ----------------------------------aaccgggagctggtgg
Q64373_BCL2L1-01       ----------------------------------aaccgggagctggtgg
Q64373_BCL2L1-03       ----------------------------------aaccgggagctggtgg
Q64373_BCL2L1-04       ----------------------------------aaccgggagctggtgg
P10417_BCL2-01         ----------------------------------gaacagggtatgataa
P10417_BCL2-02         ----------------------------------gaacagggtatgataa
P97287_MCL1-02         ---------------------------------------ggcgccgagga
P97287_MCL1-01         ctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagga
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       ----------------------------------acacgggctctagtgg
D3Z5F7_BCL2L2-01       ----------------------------------acacgggctctagtgg
P70345_BCL2L2-04       ----------------------------------acacgggctctagtgg

Q9Z0F3_BCL2L10-01      ctgctgtctgactacatattcttctgcgcacggga---------------
O55178_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
Q0P538_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
Q07440_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
O55179_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
Q8K164_BCL2A1-01       ccactccctggctgagcactatcttcagtatgtgctacag----------
Q4FK02_BCL2A1-01       ccactccctggctgagcactatcttcagtatgtgctacag----------
O55177_BCL2A1-02       ccactccctggctgagcactatcttcagtatgtgctacag----------
Q497M6_BCL2A1-01       ccactccctggctgagcactatcttcagtatgtgctacag----------
O35843_BCL2L1-01       tcgactttctctcctacaagctttcccagaaaggatacagctgga-----
Q64373_BCL2L1-09       tcgactttctctcctacaagctttcccagaaaggatacagctgga-----
Q64373_BCL2L1-01       tcgactttctctcctacaagctttcccagaaaggatacagctgga-----
Q64373_BCL2L1-03       tcgactttctctcctacaagctttcccagaaaggatacagctgga-----
Q64373_BCL2L1-04       tcgactttctctcctacaagctttcccagaaaggatacagctgga-----
P10417_BCL2-01         ccgggagatcgtgatgaagtacatacattataagctgtcacagaggg---
P10417_BCL2-02         ccgggagatcgtgatgaagtacatacattataagctgtcacagaggg---
P97287_MCL1-02         ccccgacgtcaccgcgtcggccg------aaaggcggctgcataagtcgc
P97287_MCL1-01         ccccgacgtcaccgcgtcggccg------aaaggcggctgcataagtcgc
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       c-------tgactttgtaggct-------ataagctgaggcagaagg---
D3Z5F7_BCL2L2-01       c-------tgactttgtaggct-------ataagctgaggcagaagg---
P70345_BCL2L2-04       c-------tgactttgtaggct-------ataagctgaggcagaagg---

Q9Z0F3_BCL2L10-01      ----------------gccggaca---------------ccccagagcca
O55178_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q0P538_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q07440_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
O55179_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q8K164_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q4FK02_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
O55177_BCL2A1-02       --------------gtacccg------------------cctttgagtc-
Q497M6_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
O35843_BCL2L1-01       --gtcagtttagtgatgttgaagagaataggactgaggccccagaagaaa
Q64373_BCL2L1-09       --gtcagtttagtgatgtcgaagagaataggactgaggccccagaagaaa
Q64373_BCL2L1-01       --gtcagtttagtgatgtcgaagagaataggactgaggccccagaagaaa
Q64373_BCL2L1-03       --gtcagtttagtgatgtcgaagagaataggactgaggccccagaagaaa
Q64373_BCL2L1-04       --gtcagtttagtgatgtcgaagagaataggactgaggccccagaagaaa
P10417_BCL2-01         --gctacgagtgggatgctggagatgcggacgcggcgcccctgggggct-
P10417_BCL2-02         --gctacgagtgggatgctggagatgcggacgcggcgcccctgggggct-
P97287_MCL1-02         ccggcctcctcgccgtgccgc------------------ccgaggagat-
P97287_MCL1-01         ccggcctcctcgccgtgccgc------------------ccgaggagat-
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       --gttatgtctgtggagctgg------------------ccctggggaa-
D3Z5F7_BCL2L2-01       --gttatgtctgtggagctgg------------------ccctggggaa-
P70345_BCL2L2-04       --gttatgtctgtggagctgg------------------ccctggggaa-

Q9Z0F3_BCL2L10-01      cc---------------------gcccacgtctgtcgaggc---------
O55178_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q0P538_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q07440_BCL2A1-01       -----------------------ggctccaagccaagca-----------
O55179_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q8K164_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q4FK02_BCL2A1-01       -----------------------ggctccaagcaaagca-----------
O55177_BCL2A1-02       -----------------------ggctccaagccaagca-----------
Q497M6_BCL2A1-01       -----------------------ggctccaagcaaagca-----------
O35843_BCL2L1-01       ctgaagcagagagggagacccccagtgccatcaatggcaacccatcctgg
Q64373_BCL2L1-09       ctgaagcagagagggagacccccagtgccatcaatggcaacccatcctgg
Q64373_BCL2L1-01       ctgaagcagagagggagacccccagtgccatcaatggcaacccatcctgg
Q64373_BCL2L1-03       ctgaagcagagagggagacccccagtgccatcaatggcaacccatcctgg
Q64373_BCL2L1-04       ctgaagcagagagggagacccccagtgccatcaatggcaacccatcctgg
P10417_BCL2-01         -----------------------gcccccacccctggcatcttctccttc
P10417_BCL2-02         -----------------------gcccccacccctggcatcttctccttc
P97287_MCL1-02         -----------------------ggccgcgtc------------------
P97287_MCL1-01         -----------------------ggccgcgtc------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       -----------------------ggcccagcc------------------
D3Z5F7_BCL2L2-01       -----------------------ggcccagcc------------------
P70345_BCL2L2-04       -----------------------ggcccagcc------------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       cacctggcggatagcccg--------------------------------
Q64373_BCL2L1-09       cacctggcggatagcccg--------------------------------
Q64373_BCL2L1-01       cacctggcggatagcccg--------------------------------
Q64373_BCL2L1-03       cacctggcggatagcccg--------------------------------
Q64373_BCL2L1-04       cacctggcggatagcccg--------------------------------
P10417_BCL2-01         cagcctgagagcaacccaatgcccgctgtgcaccgggacatggctgccag
P10417_BCL2-02         cagcctgagagcaacccaatgcccgctgtgcaccgggacatggctgccag
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------

Q9Z0F3_BCL2L10-01      ------------------------------------ggccttgcttcgct
O55178_BCL2A1-01       ------------------------------------ttcagagtgctaca
Q0P538_BCL2A1-01       ------------------------------------ttcagagtgctaca
Q07440_BCL2A1-01       ------------------------------------tgcagagtgctaca
O55179_BCL2A1-01       ------------------------------------tgcagagtgctaca
Q8K164_BCL2A1-01       ------------------------------------tgcagagtgctaca
Q4FK02_BCL2A1-01       ------------------------------------tgcagagtgctaca
O55177_BCL2A1-02       ------------------------------------tgcagagtgctaca
Q497M6_BCL2A1-01       ------------------------------------tgcagagtgctaca
O35843_BCL2L1-01       -------------------------gccgtgaatggagccactggccaca
Q64373_BCL2L1-09       -------------------------gccgtgaatggagccactggccaca
Q64373_BCL2L1-01       -------------------------gccgtgaatggagccactggccaca
Q64373_BCL2L1-03       -------------------------gccgtgaatggagccactggccaca
Q64373_BCL2L1-04       -------------------------gccgtgaatggagccactggccaca
P10417_BCL2-01         gacgtctcctctcaggcccctcgttgccaccgctgggcctgcgctcagcc
P10417_BCL2-02         gacgtctcctctcaggcccctcgttgccaccgctgggcctgcgctcagcc
P97287_MCL1-02         ------------------------------------ggccgccgccgcca
P97287_MCL1-01         ------------------------------------ggccgccgccgcca
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       ------------------------------------gccgacccgctgca
D3Z5F7_BCL2L2-01       ------------------------------------gccgacccgctgca
P70345_BCL2L2-04       ------------------------------------gccgacccgctgca

Q9Z0F3_BCL2L10-01      ------------------------------ctgtgac----taggcagat
O55178_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q0P538_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q07440_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
O55179_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q8K164_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q4FK02_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
O55177_BCL2A1-02       ----------------------aagagttgctttctccgttcagaaggaa
Q497M6_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
O35843_BCL2L1-01       gcagcagtttggatgcgcgggaggtgattcccatggcagcagtgaagcaa
Q64373_BCL2L1-09       gcagcagtttggatgcgcgggaggtgattcccatggcagcagtgaagcaa
Q64373_BCL2L1-01       gcagcagtttggatgcgcgggaggtgattcccatggcagcagtgaagcaa
Q64373_BCL2L1-03       gcagcagtttggatgcgcgggaggtgattcccatggcagcagtgaagcaa
Q64373_BCL2L1-04       gcagcagtttggatgcgcgggaggtgattcccatggcagcagtgaagcaa
P10417_BCL2-01         ------------------------------ctgtgccacctgtggtccat
P10417_BCL2-02         ------------------------------ctgtgccacctgtggtccat
P97287_MCL1-02         ------------------------------tcgtgtctccggaggaggaa
P97287_MCL1-01         ------------------------------tcgtgtctccggaggaggaa
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       ------------------------------ccaagcc-----------at
D3Z5F7_BCL2L2-01       ------------------------------ccaagcc-----------at
P70345_BCL2L2-04       ------------------------------ccaagcc-----------at

Q9Z0F3_BCL2L10-01      ccagcaggagcaccaagaatttttt-------------------------
O55178_BCL2A1-01       gt-tggaaagaacctaaagtcatacttgga--------------------
Q0P538_BCL2A1-01       gt-tggaaagaacctaaagtcatacttgga--------------------
Q07440_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
O55179_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
Q8K164_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
Q4FK02_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
O55177_BCL2A1-02       gt-tgaaaagaatctgaagtcatacttgga--------------------
Q497M6_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
O35843_BCL2L1-01       gcgctgagagaggcaggcgatgagtttgaa-------------ctgcggt
Q64373_BCL2L1-09       gcgctgagagaggcaggcgatgagtttgaa-------------ctgcggt
Q64373_BCL2L1-01       gcgctgagagaggcaggcgatgagtttgaa-------------ctgcggt
Q64373_BCL2L1-03       gcgctgagagaggcaggcgatgagtttgaa-------------ctgcggt
Q64373_BCL2L1-04       gcgctgagagaggcaggcgatgagtttgaa-------------ctgcggt
P10417_BCL2-01         ct-----gaccctccg---ccgggctggggatgacttctct--cgtcgct
P10417_BCL2-02         ct-----gaccctccg---ccgggctggggatgacttctct--cgtcgct
P97287_MCL1-02         ct-----ggacggctg----cgagccggaggccatcggcaagcgcccggc
P97287_MCL1-01         ct-----ggacggctg----cgagccggaggccatcggcaagcgcccggc
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       gc-----gggctgctggagacgagtttgag-------------acccgtt
D3Z5F7_BCL2L2-01       gc-----gggctgctggagacgagtttgag-------------acccgtt
P70345_BCL2L2-04       gc-----gggctgctggagacgagtttgag-------------acccgtt

Q9Z0F3_BCL2L10-01      ----------------------------tcctccttctgcgaaagccggg
O55178_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q0P538_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q07440_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
O55179_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q8K164_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q4FK02_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
O55177_BCL2A1-02       ----------------------------tgactttcacgtggaatccata
Q497M6_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
O35843_BCL2L1-01       accggagagcgttcagtgatctaacatcccagcttcacataa---cccca
Q64373_BCL2L1-09       accggagagcgttcagtgatctaacatcccagcttcacataa---cccca
Q64373_BCL2L1-01       accggagagcgttcagtgatctaacatcccagcttcacataa---cccca
Q64373_BCL2L1-03       accggagagcgttcagtgatctaacatcccagcttcacataa---cccca
Q64373_BCL2L1-04       accggagagcgttcagtgatctaacatcccagcttcacataa---cccca
P10417_BCL2-01         accgtcgtgacttcgcagagatgtccagtcagctgcacctga---cgccc
P10417_BCL2-02         accgtcgtgacttcgcagagatgtccagtcagctgcacctga---cgccc
P97287_MCL1-02         cgtgctgcccctcctggagcgcgtgagcgaggcggccaagag---ctccg
P97287_MCL1-01         cgtgctgcccctcctggagcgcgtgagcgaggcggccaagag---ctccg
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       tccgccgcaccttctctgacctggccgctcagctacacgtga---cccca
D3Z5F7_BCL2L2-01       tccgccgcaccttctctgacctggccgctcagctacacgtga---cccca
P70345_BCL2L2-04       tccgccgcaccttctctgacctggccgctcagctacacgtga---cccca

Q9Z0F3_BCL2L10-01      gcaatcgcctgg-agctggtgaaacagatggcagataagttgctctccaa
O55178_BCL2A1-01       gataccaccagaataatattcaaccaagtgatggaaaa---agagtttga
Q0P538_BCL2A1-01       gataccaccagaataatattcaaccaagtgatggaaaa---agagtttga
Q07440_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
O55179_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
Q8K164_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
Q4FK02_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
O55177_BCL2A1-02       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
Q497M6_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
O35843_BCL2L1-01       gggaccgcgtatcagagctttgagcaggtagtgaatga---actctttcg
Q64373_BCL2L1-09       gggaccgcgtatcagagctttgagcaggtagtgaatga---actctttcg
Q64373_BCL2L1-01       gggaccgcgtatcagagctttgagcaggtagtgaatga---actctttcg
Q64373_BCL2L1-03       gggaccgcgtatcagagctttgagcaggtagtgaatga---actctttcg
Q64373_BCL2L1-04       gggaccgcgtatcagagctttgagcaggtagtgaatga---actctttcg
P10417_BCL2-01         ttcaccgcgaggggacgctttgccacggtggtggagga---actcttcag
P10417_BCL2-02         ttcaccgcgaggggacgctttgccacggtggtggagga---actcttcag
P97287_MCL1-02         g-----ggccgacggctctctgccc---tccacgccgc---cgccgcccg
P97287_MCL1-01         g-----ggccgacggctctctgccc---tccacgccgc---cgccgcccg
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       ggctcagcccagcaacgcttcacccaggtttccgacga---acttttcca
D3Z5F7_BCL2L2-01       ggctcagcccagcaacgcttcacccaggtttccgacga---acttttcca
P70345_BCL2L2-04       ggctcagcccagcaacgcttcacccaggtttccgacga---acttttcca

Q9Z0F3_BCL2L10-01      agaccaagacttcagctggagccaactggtgatgctcctggccttcgcgg
O55178_BCL2A1-01       agatggcatcattaattggggaaggattgtgactatatttgcctttgggg
Q0P538_BCL2A1-01       aaatggcatcattaattggggaaggattgtgactatatttgcctttgggg
Q07440_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
O55179_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
Q8K164_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
Q4FK02_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
O55177_BCL2A1-02       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
Q497M6_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
O35843_BCL2L1-01       ggatgg---agtaaactggggtcgcatcgtggcctttttctcctttggcg
Q64373_BCL2L1-09       ggatgg---agtaaactggggtcgcatcgtggcctttttctcctttggcg
Q64373_BCL2L1-01       ggatgg---agtaaactggggtcgcatcgtggcctttttctcctttggcg
Q64373_BCL2L1-03       ggatgg---agtaaactggggtcgcatcgtggcctttttctcctttggcg
Q64373_BCL2L1-04       ggatgg---agtaaactggggtcgcatcgtggcctttttctcctttggcg
P10417_BCL2-01         ggatgg---ggtgaactgggggaggattgtggccttctttgagttcggtg
P10417_BCL2-02         ggatgg---ggtgaactgggggaggattgtggccttctttgagttcggtg
P97287_MCL1-02         aggagg---aa------gaggacgacctataccgcca---gtcgctggag
P97287_MCL1-01         aggagg---aa------gaggacgacctataccgcca---gtcgctggag
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       aggggg---ccctaactggggccgtcttgtggcattctttgtctttgggg
D3Z5F7_BCL2L2-01       aggggg---ccctaactggggccgtcttgtggcattctttgtctttgggg
P70345_BCL2L2-04       aggggg---ccctaactggggccgtcttgtggcattctttgtctttgggg

Q9Z0F3_BCL2L10-01      gg------acgcttatgaatcaaggcccttacatggctgtcaagcagaag
O55178_BCL2A1-01       gt------gttc-tcctcaaaaa--------aacttcca-caagagcaga
Q0P538_BCL2A1-01       gt------gttc-tcctcaaaaa--------aacttcca-caagagcaga
Q07440_BCL2A1-01       gt------gttc-tcctc-aaaa--------aacttcca-caagagcaga
O55179_BCL2A1-01       gt------gttc-tcctc-aaaa--------aacttcca-caagagcaga
Q8K164_BCL2A1-01       gt------gttc-tcctc-aaaa--------aacttccg-caagagcaga
Q4FK02_BCL2A1-01       gt------gttc-tcctc-aaaa--------aacttccg-caagagcaga
O55177_BCL2A1-02       gt------gttc-tcctc-aaaa--------aacttccg-caagagcaga
Q497M6_BCL2A1-01       gt------gttc-tcctc-aaaa--------aacttccg-caagagcaga
O35843_BCL2L1-01       gg------gcac-tgtgcgtgga-------aagcgtaga-caaggagatg
Q64373_BCL2L1-09       gg------gcac-tgtgcgtgga-------aagcgtaga-caaggagatg
Q64373_BCL2L1-01       gg------gcac-tgtgcgtgga-------aagcgtaga-caaggagatg
Q64373_BCL2L1-03       gg------gcac-tgtgcgtgga-------aagcgtaga-caaggagatg
Q64373_BCL2L1-04       gg------gcac-tgtgcgtgga-------aagcgtaga-caaggagatg
P10417_BCL2-01         gg------gtca-tgtgtgtgga-------gagcgtcaa-cagggagatg
P10417_BCL2-02         gg------gtca-tgtgtgtgga-------gagcgtcaa-cagggagatg
P97287_MCL1-02         atcatctcgcgc-tacttgcgggagcaggcgaccggctc-caaggactcg
P97287_MCL1-01         atcatctcgcgc-tacttgcgggagcaggcgaccggctc-caaggactcg
P70345_BCL2L2-03       -----------------------------------------------atg
P70345_BCL2L2-01       ct------gccc-tgtgtgctga-------gagtgtcaa-caaagaaatg
D3Z5F7_BCL2L2-01       ct------gccc-tgtgtgctga-------gagtgtcaa-caaagaaatg
P70345_BCL2L2-04       ct------gccc-tgtgtgctga-------gagtgtcaa-caaagaaatg

Q9Z0F3_BCL2L10-01      agggatctggggaatcgtgtcatagtgacccgagactgctgtctcatagt
O55178_BCL2A1-01       ttgccctggatgtacgtgcttacaa----acaagtttccagttttggggc
Q0P538_BCL2A1-01       ttgccctggatgtacgtgcttacaa----acaagtttccagttttggggc
Q07440_BCL2A1-01       ttgccctggatgtatgtgcttacaa----acaagtttccagttttgtggc
O55179_BCL2A1-01       ttgccctggatgtaggtgcttacaa----acaagtttccagttttgtggc
Q8K164_BCL2A1-01       ttgccctggatgtaggtgcttacaa----acaagtttccagttttgtggc
Q4FK02_BCL2A1-01       ttgccctggatgtaggtgcttacaa----acaagtttccagttttgtggc
O55177_BCL2A1-02       ttgccctggatgtaggtgcttacaa----acaagtttccagttttgtggc
Q497M6_BCL2A1-01       ttgccctggatgtaggtgcttacaa----acaagtttccagttttgtggc
O35843_BCL2L1-01       caggtattggtgagtcggattgca---------------agttggatggc
Q64373_BCL2L1-09       caggtattggtgagtcggattgca---------------agttggatggc
Q64373_BCL2L1-01       caggtattggtgagtcggattgca---------------agttggatggc
Q64373_BCL2L1-03       caggtattggtgagtcggattgca---------------agttggatggc
Q64373_BCL2L1-04       caggtattggtgagtcggattgca---------------agttggatggc
P10417_BCL2-01         tcacccctggtggacaacatcgcc------------ctg---tggatgac
P10417_BCL2-02         tcacccctggtggacaacatcgcc------------ctg---tggatgac
P97287_MCL1-02         aagcctctgggcgaggcgggcgcg------------gcgggccggagagc
P97287_MCL1-01         aagcctctgggcgaggcgggcgcg------------gcgggccggagagc
P70345_BCL2L2-03       gagccttt-ggtgggacaagtgca--------------ggattggatggt
P70345_BCL2L2-01       gagccttt-ggtgggacaagtgca--------------ggattggatggt
D3Z5F7_BCL2L2-01       gagccttt-ggtgggacaagtgca--------------ggattggatggt
P70345_BCL2L2-04       gagccttt-ggtgggacaagtgca--------------ggattggatggt

Q9Z0F3_BCL2L10-01      gaactttctgtataa---tctgctcatggggcgtcggcaccgcgccaggc
O55178_BCL2A1-01       agaattcataatgaa------taa--------------------------
Q0P538_BCL2A1-01       agaattcatcatgaa------taa--------------------------
Q07440_BCL2A1-01       agaattcataatgaa------taacacaggagaatggatacggcagaa--
O55179_BCL2A1-01       agaattcataatgaa------taacacaggagaatggatacggcggaa--
Q8K164_BCL2A1-01       agaattcataatcaa------taacacaggagaatggatacggcggaa--
Q4FK02_BCL2A1-01       agaattcataatcaa------taacacaggagaatggatacggcggaa--
O55177_BCL2A1-02       agaattcataatcaa------taacacaggagaatggatacggcggaa--
Q497M6_BCL2A1-01       agaattcataatcaa------taacacaggagaatggatacggcggaa--
O35843_BCL2L1-01       cacctatctgaatga------ccacctagagccttggatccaggagaa--
Q64373_BCL2L1-09       cacctatctgaatga------ccacctagagccttggatccaggagaa--
Q64373_BCL2L1-01       cacctatctgaatga------ccacctagagccttggatccaggagaa--
Q64373_BCL2L1-03       cacctatctgaatga------ccacctagagccttggatccaggagaa--
Q64373_BCL2L1-04       cacctatctgaatga------ccacctagagccttggatccaggagaa--
P10417_BCL2-01         tgagtacctgaa------ccggcatctgcacacctggatccaggataa--
P10417_BCL2-02         tgagtacctgaa------ccggcatctgcacacctggatccaggataa--
P97287_MCL1-02         g------ctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaacc
P97287_MCL1-01         g------ctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaacc
P70345_BCL2L2-03       ggcctacctggagac------acgtctggctgactggatccacagcag--
P70345_BCL2L2-01       ggcctacctggagac------acgtctggctgactggatccacagcag--
D3Z5F7_BCL2L2-01       ggcctacctggagac------acgtctggctgactggatccacagcag--
P70345_BCL2L2-04       ggcctacctggagac------acgtctggctgactggatccacagcag--

Q9Z0F3_BCL2L10-01      tggaggctct----------------cggcggctggg-------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------tggaggttggg-------------
O55179_BCL2A1-01       --------------------------tggaggttggg-------------
Q8K164_BCL2A1-01       --------------------------tggaggttggg-------------
Q4FK02_BCL2A1-01       --------------------------tggaggttggg-------------
O55177_BCL2A1-02       --------------------------tggaggttggg-------------
Q497M6_BCL2A1-01       --------------------------tggaggttggg-------------
O35843_BCL2L1-01       --------------------------cggcggctggggtgtgagtggagg
Q64373_BCL2L1-09       --------------------------cggcggctggga------------
Q64373_BCL2L1-01       --------------------------cggcggctggga------------
Q64373_BCL2L1-03       --------------------------cggcggctggg-------------
Q64373_BCL2L1-04       --------------------------cggcggctggg-------------
P10417_BCL2-01         --------------------------cggaggctggg-------------
P10417_BCL2-02         --------------------------cggaggctggg-------------
P97287_MCL1-02         acgagacggccttccagggcatgctccggaaactggacattaaaaa----
P97287_MCL1-01         acgagacggccttccagggcatgctccggaaactggacattaaaaa----
P70345_BCL2L2-03       --------------------------tgggggctggg-------------
P70345_BCL2L2-01       --------------------------tgggggctggg-------------
D3Z5F7_BCL2L2-01       --------------------------tgggggctgggagctagaagcgat
P70345_BCL2L2-04       --------------------------tgggggctggg-------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       tacacccctcagatctgtc-------------------------------
Q64373_BCL2L1-09       -----cacttttgtggatc-------------------------------
Q64373_BCL2L1-01       -----cacttttgtggatc-------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------atgcctttgtggaa----------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         -----------------------------------cgaag----------
P97287_MCL1-01         -----------------------------------cgaag----------
P70345_BCL2L2-03       -----------------------------------cggag----------
P70345_BCL2L2-01       -----------------------------------cggag----------
D3Z5F7_BCL2L2-01       caaagctcgagtcagggagatggaggaagaggctgagaagctaaaggagc
P70345_BCL2L2-04       ---------------------------------taagaag----------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
D3Z5F7_BCL2L2-01       tacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaat
P70345_BCL2L2-04       --------------------------------------------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
D3Z5F7_BCL2L2-01       gctggcccagtgatcatgtctcttgaggagaagatggaggctgatgcccg
P70345_BCL2L2-04       --------------------------------------------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         -----------------------------------------gcgatgtta
P97287_MCL1-01         -----------------------------------------gcgatgtta
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
D3Z5F7_BCL2L2-01       ctctatctacgttggcaatgtggactatggtgcaacagcagaagagctgg
P70345_BCL2L2-04       --------------------------------------------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         -----------------------------------ctatatggccccagc
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         aatctttttctcg----------------------agtaatggtccatg-
P97287_MCL1-01         aatctttttctcg----------------------agtaatggtccatg-
P70345_BCL2L2-03       ---------ttca-------------------------------------
P70345_BCL2L2-01       ---------ttca-------------------------------------
D3Z5F7_BCL2L2-01       aagcccattttcatggctgtggttcagtcaaccgtgttactatactctgt
P70345_BCL2L2-04       -------ttctca----------------------attgctgctctccg-

Q9Z0F3_BCL2L10-01      ------------atggcttttgccgcttcttcaagaatcctttaccgctc
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       ---------------------------------aagatggcttcataaag
O55179_BCL2A1-01       ---------------------------------aagatggcttcataaag
Q8K164_BCL2A1-01       ---------------------------------aagatggcttcataaag
Q4FK02_BCL2A1-01       ---------------------------------aagatggcttcataaag
O55177_BCL2A1-02       ---------------------------------aagatggcttcataaag
Q497M6_BCL2A1-01       ---------------------------------aagatggcttcataaag
O35843_BCL2L1-01       ---------------------------ttcagaaggcttgttcaagtgcc
Q64373_BCL2L1-09       ---------------------------tctacgggaacaatgcagcagcc
Q64373_BCL2L1-01       ---------------------------tctacgggaacaatgcagcagcc
Q64373_BCL2L1-03       -------------------------------taagaaccacgc-------
Q64373_BCL2L1-04       -------------------------------taagaaccacgc-------
P10417_BCL2-01         atgcgacctctgtttgatttctcctggctgtctctgaagaccctgctcag
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         ---------------------------ttttcaaagatggcgtaacaaac
P97287_MCL1-01         ---------------------------ttttcaaagatggcgtaacaaac
P70345_BCL2L2-03       ---------------cagctc------tatacggggacggggc-----cc
P70345_BCL2L2-01       ---------------cagctc------tatacggggacggggc-----cc
D3Z5F7_BCL2L2-01       gacaaatttagtggccatcccaaagggtttgcatatatagagt-----tc
P70345_BCL2L2-04       ---------------catccc------tctacaaagttggtct-----tc

Q9Z0F3_BCL2L10-01      ggcttctggagaagattgctga---------------ttcaggcttttct
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       aagtttgaa----------------------------cccaaatctggct
O55179_BCL2A1-01       aagtttgaa----------------------------cccaaatctggct
Q8K164_BCL2A1-01       aagtttgaa----------------------------cccaaatctggct
Q4FK02_BCL2A1-01       aagtttgaa----------------------------cccaaatctggct
O55177_BCL2A1-02       aagtttgaa----------------------------cccaaatctggct
Q497M6_BCL2A1-01       aagtttgaa----------------------------cccaaatctggct
O35843_BCL2L1-01       aggagtggcggagca----------------------cgtttgtgatccc
Q64373_BCL2L1-09       gagagccggaaaggccaggagcgcttcaaccgctggttcctgacgggcat
Q64373_BCL2L1-01       gagagccggaaaggccaggagcgcttcaaccgctggttcctgacgggcat
Q64373_BCL2L1-03       -------------------------------------cccttgtgtgtcc
Q64373_BCL2L1-04       -------------------------------------cccttgtgtgtcc
P10417_BCL2-01         cctggccctggtcggggcctgcatcactc--------tgggtgcatacct
P10417_BCL2-02         -------------------------------------taggtgcatgtct
P97287_MCL1-02         tggggcagg-attgtgactcttatttctt--------tcggtgcctttgt
P97287_MCL1-01         tggggcagg-attgtgactcttatttctt--------tcggtgcctttgt
P70345_BCL2L2-03       tggaggaggcacggcg---------tctg--------cgggaggggaact
P70345_BCL2L2-01       tggaggaggcacggcg---------tctg--------cgggaggggaact
D3Z5F7_BCL2L2-01       tcggacaaaga----g---------tcag--------tgaggacgtccct
P70345_BCL2L2-04       atgggaaaata----g----------------------------------

Q9Z0F3_BCL2L10-01      gtcag---------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       ggctg---------------------------------------------
O55179_BCL2A1-01       ggctg---------------------------------------------
Q8K164_BCL2A1-01       ggctg---------------------------------------------
Q4FK02_BCL2A1-01       ggctg---------------------------------------------
O55177_BCL2A1-02       ggctg---------------------------------------------
Q497M6_BCL2A1-01       ggctg---------------------------------------------
O35843_BCL2L1-01       agcct---------------------------------------------
Q64373_BCL2L1-09       -gact---------------------------------------------
Q64373_BCL2L1-01       -gact---------------------------------------------
Q64373_BCL2L1-03       -gccc---------------------------------------------
Q64373_BCL2L1-04       -gccc---------------------------------------------
P10417_BCL2-01         gggcc---------------------------------------------
P10417_BCL2-02         ggt-----------------------------------------------
P97287_MCL1-02         ggccaaacacttaaagagcgtaaaccaagaaagcttcatcgaaccattag
P97287_MCL1-01         ggccaaacacttaaagagcgtaaaccaagaaagcttcatcgaaccattag
P70345_BCL2L2-03       gggca-----tcagtgag--------------------------------
P70345_BCL2L2-01       gggca-----tcagtgag--------------------------------
D3Z5F7_BCL2L2-01       ggcct-----tagatgagtccctgttcagaggaagacaaatcaaggtgat
P70345_BCL2L2-04       ggcct-----ctgatggg--------------------------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------acttttctgcagatgacaggacagatctgggaa---
O55179_BCL2A1-01       --------------acttttctgcagatgacaggacagatctgggaa---
Q8K164_BCL2A1-01       --------------acttttctgcagatgacaggacagatctgggaa---
Q4FK02_BCL2A1-01       --------------acttttctgcagatgacaggacagttctgggaa---
O55177_BCL2A1-02       --------------acttttctgcagatgacaggacagttctgggaa---
Q497M6_BCL2A1-01       --------------acttttctgcagatgacaggacagttctgggaa---
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         cagaaactatcacagatgttcttgtaaggacgaaacgggactggctt---
P97287_MCL1-01         cagaaactatcacagatgttcttgtaaggacgaaacgggactggctt---
P70345_BCL2L2-03       ----------------------------gacagtgctgacgggggcc---
P70345_BCL2L2-01       ----------------------------gacagtgctgacgggggcc---
D3Z5F7_BCL2L2-01       tcccaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcc
P70345_BCL2L2-04       ------------------------------------aggctggggtt---

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         ----gtcaaacaaagaggctgggatgggtttgtggagttcttccacgtac
P97287_MCL1-01         ----gtcaaacaaagaggctgggatgggtttgtggagttcttccacgtac
P70345_BCL2L2-03       ------------gtggcactgggg--------------------------
P70345_BCL2L2-01       ------------gtggcactgggg--------------------------
D3Z5F7_BCL2L2-01       cgcgctcccgataccgtgcccggactaccaactacaacagctcccgatct
P70345_BCL2L2-04       ---------------gtgctggga--------------------------

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------ttgggaggtggaaacaga
Q64373_BCL2L1-09       --------------------------------gtggctggtgt-------
Q64373_BCL2L1-01       --------------------------------gtggctggtgt-------
Q64373_BCL2L1-03       --------------------------------cttgcttgtgt-------
Q64373_BCL2L1-04       --------------------------------cttgcttgtgt-------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P97287_MCL1-02         aggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgtt
P97287_MCL1-01         aggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgtt
P70345_BCL2L2-03       --------------------------------------------gccctg
P70345_BCL2L2-01       --------------------------------------------gccctg
D3Z5F7_BCL2L2-01       cgattctacagtg-------------gttttaacagcaggccccggggtc
P70345_BCL2L2-04       --------------------------------------------------

Q9Z0F3_BCL2L10-01      ------------gcttctttgcaacagccatcttttttatctggaaacgt
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       -----------------------------atgctctttctcctcaa----
O55179_BCL2A1-01       -----------------------------atgctctttctcctcaa----
Q8K164_BCL2A1-01       -----------------------------atgctctttctcctcaa----
Q4FK02_BCL2A1-01       -----------------------------atgctctttctcctcaa----
O55177_BCL2A1-02       -----------------------------atgctctttctcctcaa----
Q497M6_BCL2A1-01       -----------------------------atgctctttctcctcaa----
O35843_BCL2L1-01       aggatcggaagttcaaggccctcctcagctatta----------------
Q64373_BCL2L1-09       ----------------ggttctgctgggctcactcttcagtcggaa----
Q64373_BCL2L1-01       ----------------ggttctgctgggctcactcttcagtcggaa----
Q64373_BCL2L1-03       ----------------ctctcttctctgtgaacatccc------------
Q64373_BCL2L1-04       ----------------ctctcttctctgtgaacatccc------------
P10417_BCL2-01         ------------------------------------------acaa----
P10417_BCL2-02         -------------------------------------------tga----
P97287_MCL1-02         gctggagtaggggctggtctggca-----------tatctaataag----
P97287_MCL1-01         gctggagtaggggctggtctggca-----------tatctaataag----
P70345_BCL2L2-03       gtaactgtaggggcc-----------------ttttttgctagcaa----
P70345_BCL2L2-01       gtaactgtaggggcc-----------------ttttttgctagcaa----
D3Z5F7_BCL2L2-01       gaatctacaggggccgggctagagcgacatcatggtattcccctta----
P70345_BCL2L2-04       --------aggg--------------------------------------

Q9Z0F3_BCL2L10-01      ttataa
O55178_BCL2A1-01       ------
Q0P538_BCL2A1-01       ------
Q07440_BCL2A1-01       --gtaa
O55179_BCL2A1-01       --gtaa
Q8K164_BCL2A1-01       --gtaa
Q4FK02_BCL2A1-01       --gtag
O55177_BCL2A1-02       --gtaa
Q497M6_BCL2A1-01       --gtaa
O35843_BCL2L1-01       ---tag
Q64373_BCL2L1-09       --gtga
Q64373_BCL2L1-01       --gtga
Q64373_BCL2L1-03       ---taa
Q64373_BCL2L1-04       ---taa
P10417_BCL2-01         --gtga
P10417_BCL2-02         --atga
P97287_MCL1-02         --atag
P97287_MCL1-01         --atag
P70345_BCL2L2-03       --gtga
P70345_BCL2L2-01       --gtga
D3Z5F7_BCL2L2-01       --ctaa
P70345_BCL2L2-04       --ctga

© 1998-2019