Dataset for CDS BCL-2-like of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

18 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9Z0F3_BCL2L10-01      atggccgactcgcagg---------------acccactgcatgaacgcac
O55178_BCL2A1-01       atg----------------------------gctgagtacgagctcatgc
Q0P538_BCL2A1-01       atg----------------------------gctgagtacgagctcatgc
Q07440_BCL2A1-01       atg----------------------------gctgagtctgagctcatgc
O55179_BCL2A1-01       atg----------------------------tctgagtacgagttcatgt
Q8K164_BCL2A1-01       atg----------------------------gctgagtacgagttcatgt
Q4FK02_BCL2A1-01       atg----------------------------tctgagtacgagttcatgt
O55177_BCL2A1-02       atg----------------------------gctgagtacgagttcatgt
Q497M6_BCL2A1-01       atg----------------------------gctgagtacgagttcatgt
O35843_BCL2L1-01       atg----------------------------tctcagagc----------
P10417_BCL2-02         atg----------------------------gcgcaagccggga------
P10417_BCL2-01         atg----------------------------gcgcaagccggga------
P97287_MCL1-02         atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
P97287_MCL1-01         atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
P70345_BCL2L2-01       atg------------------gcgaccccagcctcaaccccagac-----
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       atg------------------gcgaccccagcctcaaccccagac-----
P70345_BCL2L2-04       atg------------------gcgaccccagcctcaaccccagac-----
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         c-------------------------------------------------
P97287_MCL1-01         cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         tggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctg
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      -------------------------------------------tagacgg
O55178_BCL2A1-01       ----------------------------------------------atat
Q0P538_BCL2A1-01       ----------------------------------------------atat
Q07440_BCL2A1-01       ----------------------------------------------atat
O55179_BCL2A1-01       ----------------------------------------------atat
Q8K164_BCL2A1-01       ----------------------------------------------atat
Q4FK02_BCL2A1-01       ----------------------------------------------atat
O55177_BCL2A1-02       ----------------------------------------------atat
Q497M6_BCL2A1-01       ----------------------------------------------atat
O35843_BCL2L1-01       ----------------------------------aaccgggagctggtgg
P10417_BCL2-02         ----------------------------------gaacagggtatgataa
P10417_BCL2-01         ----------------------------------gaacagggtatgataa
P97287_MCL1-02         ---------------------------------------ggcgccgagga
P97287_MCL1-01         ctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagga
P70345_BCL2L2-01       ----------------------------------acacgggctctagtgg
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       ----------------------------------acacgggctctagtgg
P70345_BCL2L2-04       ----------------------------------acacgggctctagtgg
                                                                         

Q9Z0F3_BCL2L10-01      ctgctgtctgactacatattcttctgcgcacgg-----------------
O55178_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
Q0P538_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
Q07440_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
O55179_BCL2A1-01       ccactccctggctgagcactaccttcagtatgtgctacag----------
Q8K164_BCL2A1-01       ccactccctggctgagcactatcttcagtatgtgctacag----------
Q4FK02_BCL2A1-01       ccactccctggctgagcactatcttcagtatgtgctacag----------
O55177_BCL2A1-02       ccactccctggctgagcactatcttcagtatgtgctacag----------
Q497M6_BCL2A1-01       ccactccctggctgagcactatcttcagtatgtgctacag----------
O35843_BCL2L1-01       tcgactttctctcctacaagctttcccagaaaggatacagctgga-----
P10417_BCL2-02         ccgggagatcgtgatgaagtacatacattataagctgtcacagaggg---
P10417_BCL2-01         ccgggagatcgtgatgaagtacatacattataagctgtcacagaggg---
P97287_MCL1-02         ccccgacgtcaccgcgtcggccg------aaaggcggctgcataagtcgc
P97287_MCL1-01         ccccgacgtcaccgcgtcggccg------aaaggcggctgcataagtcgc
P70345_BCL2L2-01       c-------tgactttgtaggct-------ataagctgaggcagaagg---
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       c-------tgactttgtaggct-------ataagctgaggcagaagg---
P70345_BCL2L2-04       c-------tgactttgtaggct-------ataagctgaggcagaagg---
                                                                         

Q9Z0F3_BCL2L10-01      --------------gagccggaca---------------ccccagagcca
O55178_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q0P538_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q07440_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
O55179_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q8K164_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
Q4FK02_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
O55177_BCL2A1-02       --------------gtacccg------------------cctttgagtc-
Q497M6_BCL2A1-01       --------------gtacccg------------------cctttgagtc-
O35843_BCL2L1-01       --gtcagtttagtgatgttgaagagaataggactgaggccccagaagaaa
P10417_BCL2-02         --gctacgagtgggatgctggagatgcggacgcggcgcccctgggggct-
P10417_BCL2-01         --gctacgagtgggatgctggagatgcggacgcggcgcccctgggggct-
P97287_MCL1-02         ccggcctcctcgccgtgccgc------------------ccgaggagat-
P97287_MCL1-01         ccggcctcctcgccgtgccgc------------------ccgaggagat-
P70345_BCL2L2-01       --gttatgtctgtggagctgg------------------ccctggggaa-
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       --gttatgtctgtggagctgg------------------ccctggggaa-
P70345_BCL2L2-04       --gttatgtctgtggagctgg------------------ccctggggaa-
                                                                         

Q9Z0F3_BCL2L10-01      cc---------------------gcccacgtctgtcgaggc---------
O55178_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q0P538_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q07440_BCL2A1-01       -----------------------ggctccaagccaagca-----------
O55179_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q8K164_BCL2A1-01       -----------------------ggctccaagccaagca-----------
Q4FK02_BCL2A1-01       -----------------------ggctccaagcaaagca-----------
O55177_BCL2A1-02       -----------------------ggctccaagccaagca-----------
Q497M6_BCL2A1-01       -----------------------ggctccaagcaaagca-----------
O35843_BCL2L1-01       ctgaagcagagagggagacccccagtgccatcaatggcaacccatcctgg
P10417_BCL2-02         -----------------------gcccccacccctggcatcttctccttc
P10417_BCL2-01         -----------------------gcccccacccctggcatcttctccttc
P97287_MCL1-02         -----------------------ggccgcgtc------------------
P97287_MCL1-01         -----------------------ggccgcgtc------------------
P70345_BCL2L2-01       -----------------------ggcccagcc------------------
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       -----------------------ggcccagcc------------------
P70345_BCL2L2-04       -----------------------ggcccagcc------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       cacctggcggatagcccg--------------------------------
P10417_BCL2-02         cagcctgagagcaacccaatgcccgctgtgcaccgggacatggctgccag
P10417_BCL2-01         cagcctgagagcaacccaatgcccgctgtgcaccgggacatggctgccag
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      ------------------------------------ggccttgcttcgct
O55178_BCL2A1-01       ------------------------------------ttcagagtgctaca
Q0P538_BCL2A1-01       ------------------------------------ttcagagtgctaca
Q07440_BCL2A1-01       ------------------------------------tgcagagtgctaca
O55179_BCL2A1-01       ------------------------------------tgcagagtgctaca
Q8K164_BCL2A1-01       ------------------------------------tgcagagtgctaca
Q4FK02_BCL2A1-01       ------------------------------------tgcagagtgctaca
O55177_BCL2A1-02       ------------------------------------tgcagagtgctaca
Q497M6_BCL2A1-01       ------------------------------------tgcagagtgctaca
O35843_BCL2L1-01       -------------------------gccgtgaatggagccactggccaca
P10417_BCL2-02         gacgtctcctctcaggcccctcgttgccaccgctgggcctgcgctcagcc
P10417_BCL2-01         gacgtctcctctcaggcccctcgttgccaccgctgggcctgcgctcagcc
P97287_MCL1-02         ------------------------------------ggccgccgccgcca
P97287_MCL1-01         ------------------------------------ggccgccgccgcca
P70345_BCL2L2-01       ------------------------------------gccgacccgctgca
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       ------------------------------------gccgacccgctgca
P70345_BCL2L2-04       ------------------------------------gccgacccgctgca
                                                                         

Q9Z0F3_BCL2L10-01      ------------------------------ctgtgac----taggcagat
O55178_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q0P538_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q07440_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
O55179_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q8K164_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
Q4FK02_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
O55177_BCL2A1-02       ----------------------aagagttgctttctccgttcagaaggaa
Q497M6_BCL2A1-01       ----------------------aagagttgctttctccgttcagaaggaa
O35843_BCL2L1-01       gcagcagtttggatgcgcgggaggtgattcccatggcagcagtgaagcaa
P10417_BCL2-02         ------------------------------ctgtgccacctgtggtccat
P10417_BCL2-01         ------------------------------ctgtgccacctgtggtccat
P97287_MCL1-02         ------------------------------tcgtgtctccggaggaggaa
P97287_MCL1-01         ------------------------------tcgtgtctccggaggaggaa
P70345_BCL2L2-01       ------------------------------ccaagcc-----------at
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       ------------------------------ccaagcc-----------at
P70345_BCL2L2-04       ------------------------------ccaagcc-----------at
                                                                         

Q9Z0F3_BCL2L10-01      ccagcaggagcaccaagaatttttt-------------------------
O55178_BCL2A1-01       gt-tggaaagaacctaaagtcatacttgga--------------------
Q0P538_BCL2A1-01       gt-tggaaagaacctaaagtcatacttgga--------------------
Q07440_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
O55179_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
Q8K164_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
Q4FK02_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
O55177_BCL2A1-02       gt-tgaaaagaatctgaagtcatacttgga--------------------
Q497M6_BCL2A1-01       gt-tgaaaagaatctgaagtcatacttgga--------------------
O35843_BCL2L1-01       gcgctgagagaggcaggcgatgagtttgaa-------------ctgcggt
P10417_BCL2-02         ct-----gaccctccg---ccgggctggggatgacttctct--cgtcgct
P10417_BCL2-01         ct-----gaccctccg---ccgggctggggatgacttctct--cgtcgct
P97287_MCL1-02         ct-----ggacggctg----cgagccggaggccatcggcaagcgcccggc
P97287_MCL1-01         ct-----ggacggctg----cgagccggaggccatcggcaagcgcccggc
P70345_BCL2L2-01       gc-----gggctgctggagacgagtttgag-------------acccgtt
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       gc-----gggctgctggagacgagtttgag-------------acccgtt
P70345_BCL2L2-04       gc-----gggctgctggagacgagtttgag-------------acccgtt
                                                                         

Q9Z0F3_BCL2L10-01      ----------------------------tcctccttctgcgaaagccggg
O55178_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q0P538_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q07440_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
O55179_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q8K164_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
Q4FK02_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
O55177_BCL2A1-02       ----------------------------tgactttcacgtggaatccata
Q497M6_BCL2A1-01       ----------------------------tgactttcacgtggaatccata
O35843_BCL2L1-01       accggagagcgttcagtgatctaacatcccagcttcacataa---cccca
P10417_BCL2-02         accgtcgtgacttcgcagagatgtccagtcagctgcacctga---cgccc
P10417_BCL2-01         accgtcgtgacttcgcagagatgtccagtcagctgcacctga---cgccc
P97287_MCL1-02         cgtgctgcccctcctggagcgcgtgagcgaggcggccaagag---ctccg
P97287_MCL1-01         cgtgctgcccctcctggagcgcgtgagcgaggcggccaagag---ctccg
P70345_BCL2L2-01       tccgccgcaccttctctgacctggccgctcagctacacgtga---cccca
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       tccgccgcaccttctctgacctggccgctcagctacacgtga---cccca
P70345_BCL2L2-04       tccgccgcaccttctctgacctggccgctcagctacacgtga---cccca
                                                                         

Q9Z0F3_BCL2L10-01      gcaatcgcctgg-agctggtgaaacagatggcagataagttgctctccaa
O55178_BCL2A1-01       gataccaccagaataatattcaaccaagtgatggaaaa---agagtttga
Q0P538_BCL2A1-01       gataccaccagaataatattcaaccaagtgatggaaaa---agagtttga
Q07440_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
O55179_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
Q8K164_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
Q4FK02_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
O55177_BCL2A1-02       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
Q497M6_BCL2A1-01       gataccgccagaataatattcaaccaagtgatggaaaa---agagtttga
O35843_BCL2L1-01       gggaccgcgtatcagagctttgagcaggtagtgaatga---actctttcg
P10417_BCL2-02         ttcaccgcgaggggacgctttgccacggtggtggagga---actcttcag
P10417_BCL2-01         ttcaccgcgaggggacgctttgccacggtggtggagga---actcttcag
P97287_MCL1-02         g-----ggccgacggctctctgccc---tccacgccgc---cgccgcccg
P97287_MCL1-01         g-----ggccgacggctctctgccc---tccacgccgc---cgccgcccg
P70345_BCL2L2-01       ggctcagcccagcaacgcttcacccaggtttccgacga---acttttcca
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       ggctcagcccagcaacgcttcacccaggtttccgacga---acttttcca
P70345_BCL2L2-04       ggctcagcccagcaacgcttcacccaggtttccgacga---acttttcca
                                                                         

Q9Z0F3_BCL2L10-01      agaccaagacttcagctggagccaactggtgatgctcctggccttcgcgg
O55178_BCL2A1-01       agatggcatcattaattggggaaggattgtgactatatttgcctttgggg
Q0P538_BCL2A1-01       aaatggcatcattaattggggaaggattgtgactatatttgcctttgggg
Q07440_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
O55179_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
Q8K164_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
Q4FK02_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
O55177_BCL2A1-02       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
Q497M6_BCL2A1-01       agatggcatcattaactggggaaggattgtgactatatttgcctttgggg
O35843_BCL2L1-01       ggatgga---gtaaactggggtcgcatcgtggcctttttctcctttggcg
P10417_BCL2-02         ggatggg---gtgaactgggggaggattgtggccttctttgagttcggtg
P10417_BCL2-01         ggatggg---gtgaactgggggaggattgtggccttctttgagttcggtg
P97287_MCL1-02         aggagga---a------gaggacgacctataccgcca---gtcgctggag
P97287_MCL1-01         aggagga---a------gaggacgacctataccgcca---gtcgctggag
P70345_BCL2L2-01       agggggc---cctaactggggccgtcttgtggcattctttgtctttgggg
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       agggggc---cctaactggggccgtcttgtggcattctttgtctttgggg
P70345_BCL2L2-04       agggggc---cctaactggggccgtcttgtggcattctttgtctttgggg
                                                                         

Q9Z0F3_BCL2L10-01      gg---------acgcttatgaatcaaggcccttacatggctgtcaagcag
O55178_BCL2A1-01       gt------gttctcctcaaaaa----------------------------
Q0P538_BCL2A1-01       gt------gttctcctcaaaaa----------------------------
Q07440_BCL2A1-01       gt------gttctcctc-aaaa----------------------------
O55179_BCL2A1-01       gt------gttctcctc-aaaa----------------------------
Q8K164_BCL2A1-01       gt------gttctcctc-aaaa----------------------------
Q4FK02_BCL2A1-01       gt------gttctcctc-aaaa----------------------------
O55177_BCL2A1-02       gt------gttctcctc-aaaa----------------------------
Q497M6_BCL2A1-01       gt------gttctcctc-aaaa----------------------------
O35843_BCL2L1-01       gg------gcactgtgcgtgga------------aagcgtagacaaggag
P10417_BCL2-02         gg------gtcatgtgtgtgga------------gagcgtcaacagggag
P10417_BCL2-01         gg------gtcatgtgtgtgga------------gagcgtcaacagggag
P97287_MCL1-02         atcatctcgcgctacttgcgggagcaggc-----gaccggctccaaggac
P97287_MCL1-01         atcatctcgcgctacttgcgggagcaggc-----gaccggctccaaggac
P70345_BCL2L2-01       ct------gccctgtgtgctga------------gagtgtcaacaaagaa
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       ct------gccctgtgtgctga------------gagtgtcaacaaagaa
P70345_BCL2L2-04       ct------gccctgtgtgctga------------gagtgtcaacaaagaa
                                                                         

Q9Z0F3_BCL2L10-01      aagagggatctggggaatcgtgtcatagtgacccgagactgctgtctcat
O55178_BCL2A1-01       ----aacttccacaagagcagattgcc-----ctgg------------at
Q0P538_BCL2A1-01       ----aacttccacaagagcagattgcc-----ctgg------------at
Q07440_BCL2A1-01       ----aacttccacaagagcagattgcc-----ctgg------------at
O55179_BCL2A1-01       ----aacttccacaagagcagattgcc-----ctgg------------at
Q8K164_BCL2A1-01       ----aacttccgcaagagcagattgcc-----ctgg------------at
Q4FK02_BCL2A1-01       ----aacttccgcaagagcagattgcc-----ctgg------------at
O55177_BCL2A1-02       ----aacttccgcaagagcagattgcc-----ctgg------------at
Q497M6_BCL2A1-01       ----aacttccgcaagagcagattgcc-----ctgg------------at
O35843_BCL2L1-01       atgcaggtattggtgagtcggattgca---agttgg------------at
P10417_BCL2-02         atgtcacccctggtggacaacatcgccctg---tgg------------at
P10417_BCL2-01         atgtcacccctggtggacaacatcgccctg---tgg------------at
P97287_MCL1-02         tcgaagcctctgggcgaggcgggcgcggcgggccgg------------ag
P97287_MCL1-01         tcgaagcctctgggcgaggcgggcgcggcgggccgg------------ag
P70345_BCL2L2-01       atggagccttt-ggtgggacaagtgca--ggattgg------------at
P70345_BCL2L2-03       atggagccttt-ggtgggacaagtgca--ggattgg------------at
D3Z5F7_BCL2L2-01       atggagccttt-ggtgggacaagtgca--ggattgg------------at
P70345_BCL2L2-04       atggagccttt-ggtgggacaagtgca--ggattgg------------at
                                                         *             * 

Q9Z0F3_BCL2L10-01      agtgaactttctgtataa---tctgctcatggggcgtcggcaccgcgcca
O55178_BCL2A1-01       g--tacgtgcttacaaacaagtttccagttttggggcagaattcataatg
Q0P538_BCL2A1-01       g--tacgtgcttacaaacaagtttccagttttggggcagaattcatcatg
Q07440_BCL2A1-01       g--tatgtgcttacaaacaagtttccagttttgtggcagaattcataatg
O55179_BCL2A1-01       g--taggtgcttacaaacaagtttccagttttgtggcagaattcataatg
Q8K164_BCL2A1-01       g--taggtgcttacaaacaagtttccagttttgtggcagaattcataatc
Q4FK02_BCL2A1-01       g--taggtgcttacaaacaagtttccagttttgtggcagaattcataatc
O55177_BCL2A1-02       g--taggtgcttacaaacaagtttccagttttgtggcagaattcataatc
Q497M6_BCL2A1-01       g--taggtgcttacaaacaagtttccagttttgtggcagaattcataatc
O35843_BCL2L1-01       ggccacctatctgaatga------ccacctagagccttggatccaggaga
P10417_BCL2-02         gactgagtacctgaa------ccggcatctgcacacctggatccaggata
P10417_BCL2-01         gactgagtacctgaa------ccggcatctgcacacctggatccaggata
P97287_MCL1-02         agcg------ctggagaccctgcggcgcgtgggcgacggcgtgcagcgca
P97287_MCL1-01         agcg------ctggagaccctgcggcgcgtgggcgacggcgtgcagcgca
P70345_BCL2L2-01       ggtggcctacctggagac------acgtctggctgactggatccacagca
P70345_BCL2L2-03       ggtggcctacctggagac------acgtctggctgactggatccacagca
D3Z5F7_BCL2L2-01       ggtggcctacctggagac------acgtctggctgactggatccacagca
P70345_BCL2L2-04       ggtggcctacctggagac------acgtctggctgactggatccacagca
                                  *  *          *   *        *    *      

Q9Z0F3_BCL2L10-01      ggctggaggctct----------------cggcggctggg----------
O55178_BCL2A1-01       aataa---------------------------------------------
Q0P538_BCL2A1-01       aataa---------------------------------------------
Q07440_BCL2A1-01       aataacacaggagaatggatacggcagaatggaggttggg----------
O55179_BCL2A1-01       aataacacaggagaatggatacggcggaatggaggttggg----------
Q8K164_BCL2A1-01       aataacacaggagaatggatacggcggaatggaggttggg----------
Q4FK02_BCL2A1-01       aataacacaggagaatggatacggcggaatggaggttggg----------
O55177_BCL2A1-02       aataacacaggagaatggatacggcggaatggaggttggg----------
Q497M6_BCL2A1-01       aataacacaggagaatggatacggcggaatggaggttggg----------
O35843_BCL2L1-01       a----------------------------cggcggctggg----------
P10417_BCL2-02         a----------------------------cggaggctggg----------
P10417_BCL2-01         a----------------------------cggaggctggg----------
P97287_MCL1-02         accacgagacggccttccagggcatgctccggaaactggacattaaaaa-
P97287_MCL1-01         accacgagacggccttccagggcatgctccggaaactggacattaaaaa-
P70345_BCL2L2-01       g----------------------------tgggggctggg----------
P70345_BCL2L2-03       g----------------------------tgggggctggg----------
D3Z5F7_BCL2L2-01       g----------------------------tgggggctgggagctagaagc
P70345_BCL2L2-04       g----------------------------tgggggctggg----------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       -------------------------------gtgtgagtggag-------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         -----------------------------atgcctttgtggaa-------
P97287_MCL1-02         --------------------------------------cgaag-------
P97287_MCL1-01         --------------------------------------cgaag-------
P70345_BCL2L2-01       --------------------------------------cggag-------
P70345_BCL2L2-03       --------------------------------------cggag-------
D3Z5F7_BCL2L2-01       gatcaaagctcgagtcagggagatggaggaagaggctgagaagctaaagg
P70345_BCL2L2-04       ------------------------------------taagaag-------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       agctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggc
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       aatgctggcccagtgatcatgtctcttgaggagaagatggaggctgatgc
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------gcgatg
P97287_MCL1-01         --------------------------------------------gcgatg
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
D3Z5F7_BCL2L2-01       ccgctctatctacgttggcaatgtggactatggtgcaacagcagaagagc
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       ----gtacacccctcagatc------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------ctatatggcccc
P97287_MCL1-02         ttaaatctttttctcg----------------------agtaatggtcca
P97287_MCL1-01         ttaaatctttttctcg----------------------agtaatggtcca
P70345_BCL2L2-01       ------------ttca----------------------------------
P70345_BCL2L2-03       ------------ttca----------------------------------
D3Z5F7_BCL2L2-01       tggaagcccattttcatggctgtggttcagtcaaccgtgttactatactc
P70345_BCL2L2-04       ----------ttctca----------------------attgctgctctc
                                                                         

Q9Z0F3_BCL2L10-01      ---------------------------------------atggcttttgc
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       ------------------------------------aagatggcttcata
O55179_BCL2A1-01       ------------------------------------aagatggcttcata
Q8K164_BCL2A1-01       ------------------------------------aagatggcttcata
Q4FK02_BCL2A1-01       ------------------------------------aagatggcttcata
O55177_BCL2A1-02       ------------------------------------aagatggcttcata
Q497M6_BCL2A1-01       ------------------------------------aagatggcttcata
O35843_BCL2L1-01       ------------------------------tgtcttcagaaggcttgttc
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         agcatgcgacctctgtttgatttctcctggctgtctctgaagaccctgct
P97287_MCL1-02         tg----------------------------ttttcaaagatggcgtaaca
P97287_MCL1-01         tg----------------------------ttttcaaagatggcgtaaca
P70345_BCL2L2-01       ------------------cagctc------tatacggggacggggc----
P70345_BCL2L2-03       ------------------cagctc------tatacggggacggggc----
D3Z5F7_BCL2L2-01       tgtgacaaatttagtggccatcccaaagggtttgcatatatagagt----
P70345_BCL2L2-04       cg----------------catccc------tctacaaagttggtct----
                                                                         

Q9Z0F3_BCL2L10-01      cgcttcttcaagaatcctttaccgctcggcttctggagaagattgctgat
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       aaga--------------------------agtttgaacccaaatctggc
O55179_BCL2A1-01       aaga--------------------------agtttgaacccaaatctggc
Q8K164_BCL2A1-01       aaga--------------------------agtttgaacccaaatctggc
Q4FK02_BCL2A1-01       aaga--------------------------agtttgaacccaaatctggc
O55177_BCL2A1-02       aaga--------------------------agtttgaacccaaatctggc
Q497M6_BCL2A1-01       aaga--------------------------agtttgaacccaaatctggc
O35843_BCL2L1-01       aagt--gccaggagt--ggcg--------------gagcacgtttgtgat
P10417_BCL2-02         ----------------------------------taggtgcatgtctggt
P10417_BCL2-01         cagcctggccctggt--cggggcctgcatcactctgggtgcatacctggg
P97287_MCL1-02         aactggggcagg-at--tgtgactcttatttctttcggtgcctttgtggc
P97287_MCL1-01         aactggggcagg-at--tgtgactcttatttctttcggtgcctttgtggc
P70345_BCL2L2-01       -cctggaggaggcac--ggcg---------tctgcgggaggggaactggg
P70345_BCL2L2-03       -cctggaggaggcac--ggcg---------tctgcgggaggggaactggg
D3Z5F7_BCL2L2-01       -tctcggacaaaga------g---------tcagtgaggacgtccctggc
P70345_BCL2L2-04       -tcatgggaaaata------g--------------------------ggc
                                                                         

Q9Z0F3_BCL2L10-01      tcaggcttttctgtc-----------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       tg------------------------------------------------
O55179_BCL2A1-01       tg------------------------------------------------
Q8K164_BCL2A1-01       tg------------------------------------------------
Q4FK02_BCL2A1-01       tg------------------------------------------------
O55177_BCL2A1-02       tg------------------------------------------------
Q497M6_BCL2A1-01       tg------------------------------------------------
O35843_BCL2L1-01       cccagcctttgggag-----------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         cc------------------------------------------------
P97287_MCL1-02         caaacacttaaagagcgtaaaccaagaaagcttcatcgaaccattagcag
P97287_MCL1-01         caaacacttaaagagcgtaaaccaagaaagcttcatcgaaccattagcag
P70345_BCL2L2-01       ca-----tcagtgag-----------------------------------
P70345_BCL2L2-03       ca-----tcagtgag-----------------------------------
D3Z5F7_BCL2L2-01       ct-----tagatgagtccctgttcagaggaagacaaatcaaggtgattcc
P70345_BCL2L2-04       ct-----ctgatggg-----------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       -------gctgacttttctgcagatgacaggacagatctgggaa------
O55179_BCL2A1-01       -------gctgacttttctgcagatgacaggacagatctgggaa------
Q8K164_BCL2A1-01       -------gctgacttttctgcagatgacaggacagatctgggaa------
Q4FK02_BCL2A1-01       -------gctgacttttctgcagatgacaggacagttctgggaa------
O55177_BCL2A1-02       -------gctgacttttctgcagatgacaggacagttctgggaa------
Q497M6_BCL2A1-01       -------gctgacttttctgcagatgacaggacagttctgggaa------
O35843_BCL2L1-01       --------------------gtggaaacagaaggatcggaagtt------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         aaactatcacagatgttcttgtaaggacgaaacgggactggctt------
P97287_MCL1-01         aaactatcacagatgttcttgtaaggacgaaacgggactggctt------
P70345_BCL2L2-01       -------------------------gacagtgctgacgggggcc------
P70345_BCL2L2-03       -------------------------gacagtgctgacgggggcc------
D3Z5F7_BCL2L2-01       caaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccgc
P70345_BCL2L2-04       ---------------------------------aggctggggtt------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         -gtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacagg
P97287_MCL1-01         -gtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacagg
P70345_BCL2L2-01       ---------gtggcactgggg-----------------------------
P70345_BCL2L2-03       ---------gtggcactgggg-----------------------------
D3Z5F7_BCL2L2-01       gctcccgataccgtgcccggactaccaactacaacagctcccgatctcga
P70345_BCL2L2-04       ------------gtgctggga-----------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-02         acctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
P97287_MCL1-01         acctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
P70345_BCL2L2-01       -----------------------------------------gccctggta
P70345_BCL2L2-03       -----------------------------------------gccctggta
D3Z5F7_BCL2L2-01       ttctacagtg-------------gttttaacagcaggccccggggtcgaa
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      -------aggcttctttgcaacagccatcttttttatctggaaacgttta
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------atgctctttctcctcaa------g
O55179_BCL2A1-01       --------------------------atgctctttctcctcaa------g
Q8K164_BCL2A1-01       --------------------------atgctctttctcctcaa------g
Q4FK02_BCL2A1-01       --------------------------atgctctttctcctcaa------g
O55177_BCL2A1-02       --------------------------atgctctttctcctcaa------g
Q497M6_BCL2A1-01       --------------------------atgctctttctcctcaa------g
O35843_BCL2L1-01       ----caaggccctcctcagct-------------------att------a
P10417_BCL2-02         ----------------------------------------tga------a
P10417_BCL2-01         ---------------------------------------acaa------g
P97287_MCL1-02         ggagtaggggctggtctggca-----------tatctaataag------a
P97287_MCL1-01         ggagtaggggctggtctggca-----------tatctaataag------a
P70345_BCL2L2-01       actgtaggggcc-----------------ttttttgctagcaa------g
P70345_BCL2L2-03       actgtaggggcc-----------------ttttttgctagcaa------g
D3Z5F7_BCL2L2-01       tctacaggggccgggctagagcgacatcatggtattcccctta------c
P70345_BCL2L2-04       -----aggg----------------------------------------c
                                                                         

Q9Z0F3_BCL2L10-01      taa
O55178_BCL2A1-01       ---
Q0P538_BCL2A1-01       ---
Q07440_BCL2A1-01       taa
O55179_BCL2A1-01       taa
Q8K164_BCL2A1-01       taa
Q4FK02_BCL2A1-01       tag
O55177_BCL2A1-02       taa
Q497M6_BCL2A1-01       taa
O35843_BCL2L1-01       tag
P10417_BCL2-02         tga
P10417_BCL2-01         tga
P97287_MCL1-02         tag
P97287_MCL1-01         tag
P70345_BCL2L2-01       tga
P70345_BCL2L2-03       tga
D3Z5F7_BCL2L2-01       taa
P70345_BCL2L2-04       tga
                          

© 1998-2018