Dataset for CDS BCL2L2 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
D3Z5F7_BCL2L2-01      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
P70345_BCL2L2-04      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
D3Z5F7_BCL2L2-01      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
P70345_BCL2L2-04      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
D3Z5F7_BCL2L2-01      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
P70345_BCL2L2-04      gggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
D3Z5F7_BCL2L2-01      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
P70345_BCL2L2-04      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
D3Z5F7_BCL2L2-01      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
P70345_BCL2L2-04      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
D3Z5F7_BCL2L2-01      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
P70345_BCL2L2-04      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt

P70345_BCL2L2-03      ------------------------------------------atggagcc
P70345_BCL2L2-01      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
D3Z5F7_BCL2L2-01      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
P70345_BCL2L2-04      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc

P70345_BCL2L2-03      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
P70345_BCL2L2-01      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
D3Z5F7_BCL2L2-01      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
P70345_BCL2L2-04      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc

P70345_BCL2L2-03      tggctgactggatccacagcagtgggggctggg-----------------
P70345_BCL2L2-01      tggctgactggatccacagcagtgggggctggg-----------------
D3Z5F7_BCL2L2-01      tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaa
P70345_BCL2L2-04      tggctgactggatccacagcagtgggggctggg-----------------

P70345_BCL2L2-03      -------------------------------cggag--------------
P70345_BCL2L2-01      -------------------------------cggag--------------
D3Z5F7_BCL2L2-01      gctcgagtcagggagatggaggaagaggctgagaagctaaaggagctaca
P70345_BCL2L2-04      -----------------------------taagaag--------------
                                                      * **              

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      --------------------------------------------------
D3Z5F7_BCL2L2-01      aaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctg
P70345_BCL2L2-04      --------------------------------------------------

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      --------------------------------------------------
D3Z5F7_BCL2L2-01      gcccagtgatcatgtctcttgaggagaagatggaggctgatgcccgctct
P70345_BCL2L2-04      --------------------------------------------------

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      --------------------------------------------------
D3Z5F7_BCL2L2-01      atctacgttggcaatgtggactatggtgcaacagcagaagagctggaagc
P70345_BCL2L2-04      --------------------------------------------------

P70345_BCL2L2-03      -----ttca-----------------------------------------
P70345_BCL2L2-01      -----ttca-----------------------------------------
D3Z5F7_BCL2L2-01      ccattttcatggctgtggttcagtcaaccgtgttactatactctgtgaca
P70345_BCL2L2-04      ---ttctca----------------------attgctgctctccg-----

P70345_BCL2L2-03      -----------cagctc------tatacggggacggggccctggaggagg
P70345_BCL2L2-01      -----------cagctc------tatacggggacggggccctggaggagg
D3Z5F7_BCL2L2-01      aatttagtggccatcccaaagggtttgcatatatagagttctcggacaaa
P70345_BCL2L2-04      -----------catccc------tctacaaagttggtcttcatgggaaaa
                                 ** * *      * * *       *    *  *   *  

P70345_BCL2L2-03      cacggcgtctgcgggaggggaactgggcatcagtgag-------------
P70345_BCL2L2-01      cacggcgtctgcgggaggggaactgggcatcagtgag-------------
D3Z5F7_BCL2L2-01      ga----gtcagtgaggacgtccctggccttagatgagtccctgttcagag
P70345_BCL2L2-04      ta----g-----------------ggcctctgatggg-------------
                       *    *                 ** *     ** *             

P70345_BCL2L2-03      -----------------------------------------------gac
P70345_BCL2L2-01      -----------------------------------------------gac
D3Z5F7_BCL2L2-01      gaagacaaatcaaggtgattcccaaacgaaccaacagaccaggcatcagc
P70345_BCL2L2-04      --------------------------------------------------

P70345_BCL2L2-03      agtgctgacgggggcc---------------gtggcactgggg-------
P70345_BCL2L2-01      agtgctgacgggggcc---------------gtggcactgggg-------
D3Z5F7_BCL2L2-01      acaacagaccggggtttcccgcgctcccgataccgtgcccggactaccaa
P70345_BCL2L2-04      -----aggctggggtt------------------gtgctggga-------
                            * * ****                    *  *  **        

P70345_BCL2L2-03      --------------------------------------------------
P70345_BCL2L2-01      --------------------------------------------------
D3Z5F7_BCL2L2-01      ctacaacagctcccgatctcgattctacagtggttttaacagcaggcccc
P70345_BCL2L2-04      --------------------------------------------------

P70345_BCL2L2-03      gccctggtaactgtaggggcc-----------------ttttttgctagc
P70345_BCL2L2-01      gccctggtaactgtaggggcc-----------------ttttttgctagc
D3Z5F7_BCL2L2-01      ggggtcgaatctacaggggccgggctagagcgacatcatggtattcccct
P70345_BCL2L2-04      --------------aggg--------------------------------

P70345_BCL2L2-03      aagtga
P70345_BCL2L2-01      aagtga
D3Z5F7_BCL2L2-01      tactaa
P70345_BCL2L2-04      --ctga
                         * *

© 1998-2019