Dataset for CDS BCL2L1 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O35843_BCL2L1-01      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-09      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-01      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-03      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-04      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
                      **************************************************

O35843_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgttgaagagaata
Q64373_BCL2L1-09      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-03      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-04      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
                      *************************************** **********

O35843_BCL2L1-01      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-09      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-01      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-03      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-04      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
                      **************************************************

O35843_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-09      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-03      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-04      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
                      **************************************************

O35843_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-09      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-03      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-04      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
                      **************************************************

O35843_BCL2L1-01      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-09      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-01      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-03      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-04      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
                      **************************************************

O35843_BCL2L1-01      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-09      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-01      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-03      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-04      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
                      **************************************************

O35843_BCL2L1-01      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-09      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-01      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-03      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-04      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
                      **************************************************

O35843_BCL2L1-01      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-09      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-01      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-03      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-04      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
                      **************************************************

O35843_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-09      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-04      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
                      **************************************************

O35843_BCL2L1-01      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-09      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-01      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-03      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-04      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
                      **************************************************

O35843_BCL2L1-01      agaacggcggctggggtgtgagtggaggtacacccctcagatctgtcttc
Q64373_BCL2L1-09      agaacggcggctggga-----------------cacttttgtggatctct
Q64373_BCL2L1-01      agaacggcggctggga-----------------cacttttgtggatctct
Q64373_BCL2L1-03      agaacggcggctggg-----------------------------------
Q64373_BCL2L1-04      agaacggcggctggg-----------------------------------
                      ***************                                   

O35843_BCL2L1-01      agaaggcttgttcaagtgccaggagtggcggagca---------------
Q64373_BCL2L1-09      acgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaac
Q64373_BCL2L1-01      acgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaac
Q64373_BCL2L1-03      -taagaaccacgc-------------------------------------
Q64373_BCL2L1-04      -taagaaccacgc-------------------------------------
                          *       *                                     

O35843_BCL2L1-01      -------cgtttgtgatcccagcctttgggaggtggaaacagaaggatcg
Q64373_BCL2L1-09      cgctggttcctgacgggcat-gactgtggctggtgt--------------
Q64373_BCL2L1-01      cgctggttcctgacgggcat-gactgtggctggtgt--------------
Q64373_BCL2L1-03      -------cccttgtgtgtcc-gccccttgcttgtgt--------------
Q64373_BCL2L1-04      -------cccttgtgtgtcc-gccccttgcttgtgt--------------
                                *   *      * *  * *   ***               

O35843_BCL2L1-01      gaagttcaaggccctcctcagctatta-------------tag
Q64373_BCL2L1-09      ---------ggttctgctgggctcactcttcagtcggaagtga
Q64373_BCL2L1-01      ---------ggttctgctgggctcactcttcagtcggaagtga
Q64373_BCL2L1-03      ---------ctctcttctctgtgaacatccc---------taa
Q64373_BCL2L1-04      ---------ctctcttctctgtgaacatccc---------taa
                                   ** **  *                   *  

© 1998-2019