Dataset for CDS BCL2A1 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O55178_BCL2A1-01      atggctgagtacgagctcatgcatatccactccctggctgagcactacct
Q0P538_BCL2A1-01      atggctgagtacgagctcatgcatatccactccctggctgagcactacct
Q07440_BCL2A1-01      atggctgagtctgagctcatgcatatccactccctggctgagcactacct
O55179_BCL2A1-01      atgtctgagtacgagttcatgtatatccactccctggctgagcactacct
Q8K164_BCL2A1-01      atggctgagtacgagttcatgtatatccactccctggctgagcactatct
Q4FK02_BCL2A1-01      atgtctgagtacgagttcatgtatatccactccctggctgagcactatct
O55177_BCL2A1-02      atggctgagtacgagttcatgtatatccactccctggctgagcactatct
Q497M6_BCL2A1-01      atggctgagtacgagttcatgtatatccactccctggctgagcactatct
                      *** ******  *** ***** ************************* **

O55178_BCL2A1-01      tcagtatgtgctacaggtacccgcctttgagtcggctccaagccaagcat
Q0P538_BCL2A1-01      tcagtatgtgctacaggtacccgcctttgagtcggctccaagccaagcat
Q07440_BCL2A1-01      tcagtatgtgctacaggtacccgcctttgagtcggctccaagccaagcat
O55179_BCL2A1-01      tcagtatgtgctacaggtacccgcctttgagtcggctccaagccaagcat
Q8K164_BCL2A1-01      tcagtatgtgctacaggtacccgcctttgagtcggctccaagccaagcat
Q4FK02_BCL2A1-01      tcagtatgtgctacaggtacccgcctttgagtcggctccaagcaaagcat
O55177_BCL2A1-02      tcagtatgtgctacaggtacccgcctttgagtcggctccaagccaagcat
Q497M6_BCL2A1-01      tcagtatgtgctacaggtacccgcctttgagtcggctccaagcaaagcat
                      ******************************************* ******

O55178_BCL2A1-01      tcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaag
Q0P538_BCL2A1-01      tcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaag
Q07440_BCL2A1-01      gcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaag
O55179_BCL2A1-01      gcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaag
Q8K164_BCL2A1-01      gcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaag
Q4FK02_BCL2A1-01      gcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaag
O55177_BCL2A1-02      gcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaag
Q497M6_BCL2A1-01      gcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaag
                       ******************************************** ****

O55178_BCL2A1-01      aacctaaagtcatacttggatgactttcacgtggaatccatagataccac
Q0P538_BCL2A1-01      aacctaaagtcatacttggatgactttcacgtggaatccatagataccac
Q07440_BCL2A1-01      aatctgaagtcatacttggatgactttcacgtggaatccatagataccgc
O55179_BCL2A1-01      aatctgaagtcatacttggatgactttcacgtggaatccatagataccgc
Q8K164_BCL2A1-01      aatctgaagtcatacttggatgactttcacgtggaatccatagataccgc
Q4FK02_BCL2A1-01      aatctgaagtcatacttggatgactttcacgtggaatccatagataccgc
O55177_BCL2A1-02      aatctgaagtcatacttggatgactttcacgtggaatccatagataccgc
Q497M6_BCL2A1-01      aatctgaagtcatacttggatgactttcacgtggaatccatagataccgc
                      ** ** ****************************************** *

O55178_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
Q0P538_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagagtttgaaaatggcatca
Q07440_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
O55179_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
Q8K164_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
Q4FK02_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
O55177_BCL2A1-02      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
Q497M6_BCL2A1-01      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
                      **************************************** *********

O55178_BCL2A1-01      ttaattggggaaggattgtgactatatttgcctttgggggtgttctcctc
Q0P538_BCL2A1-01      ttaattggggaaggattgtgactatatttgcctttgggggtgttctcctc
Q07440_BCL2A1-01      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctc
O55179_BCL2A1-01      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctc
Q8K164_BCL2A1-01      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctc
Q4FK02_BCL2A1-01      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctc
O55177_BCL2A1-02      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctc
Q497M6_BCL2A1-01      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctc
                      **** *********************************************

O55178_BCL2A1-01      aaaaaaacttccacaagagcagattgccctggatgtacgtgcttacaaac
Q0P538_BCL2A1-01      aaaaaaacttccacaagagcagattgccctggatgtacgtgcttacaaac
Q07440_BCL2A1-01      -aaaaaacttccacaagagcagattgccctggatgtatgtgcttacaaac
O55179_BCL2A1-01      -aaaaaacttccacaagagcagattgccctggatgtaggtgcttacaaac
Q8K164_BCL2A1-01      -aaaaaacttccgcaagagcagattgccctggatgtaggtgcttacaaac
Q4FK02_BCL2A1-01      -aaaaaacttccgcaagagcagattgccctggatgtaggtgcttacaaac
O55177_BCL2A1-02      -aaaaaacttccgcaagagcagattgccctggatgtaggtgcttacaaac
Q497M6_BCL2A1-01      -aaaaaacttccgcaagagcagattgccctggatgtaggtgcttacaaac
                       *********** ************************ ************

O55178_BCL2A1-01      aagtttccagttttggggcagaattcataatgaataa-------------
Q0P538_BCL2A1-01      aagtttccagttttggggcagaattcatcatgaataa-------------
Q07440_BCL2A1-01      aagtttccagttttgtggcagaattcataatgaataacacaggagaatgg
O55179_BCL2A1-01      aagtttccagttttgtggcagaattcataatgaataacacaggagaatgg
Q8K164_BCL2A1-01      aagtttccagttttgtggcagaattcataatcaataacacaggagaatgg
Q4FK02_BCL2A1-01      aagtttccagttttgtggcagaattcataatcaataacacaggagaatgg
O55177_BCL2A1-02      aagtttccagttttgtggcagaattcataatcaataacacaggagaatgg
Q497M6_BCL2A1-01      aagtttccagttttgtggcagaattcataatcaataacacaggagaatgg
                      *************** ************ ** *****             

O55178_BCL2A1-01      --------------------------------------------------
Q0P538_BCL2A1-01      --------------------------------------------------
Q07440_BCL2A1-01      atacggcagaatggaggttgggaagatggcttcataaagaagtttgaacc
O55179_BCL2A1-01      atacggcggaatggaggttgggaagatggcttcataaagaagtttgaacc
Q8K164_BCL2A1-01      atacggcggaatggaggttgggaagatggcttcataaagaagtttgaacc
Q4FK02_BCL2A1-01      atacggcggaatggaggttgggaagatggcttcataaagaagtttgaacc
O55177_BCL2A1-02      atacggcggaatggaggttgggaagatggcttcataaagaagtttgaacc
Q497M6_BCL2A1-01      atacggcggaatggaggttgggaagatggcttcataaagaagtttgaacc
                                                                        

O55178_BCL2A1-01      --------------------------------------------------
Q0P538_BCL2A1-01      --------------------------------------------------
Q07440_BCL2A1-01      caaatctggctggctgacttttctgcagatgacaggacagatctgggaaa
O55179_BCL2A1-01      caaatctggctggctgacttttctgcagatgacaggacagatctgggaaa
Q8K164_BCL2A1-01      caaatctggctggctgacttttctgcagatgacaggacagatctgggaaa
Q4FK02_BCL2A1-01      caaatctggctggctgacttttctgcagatgacaggacagttctgggaaa
O55177_BCL2A1-02      caaatctggctggctgacttttctgcagatgacaggacagttctgggaaa
Q497M6_BCL2A1-01      caaatctggctggctgacttttctgcagatgacaggacagttctgggaaa
                                                                        

O55178_BCL2A1-01      --------------------
Q0P538_BCL2A1-01      --------------------
Q07440_BCL2A1-01      tgctctttctcctcaagtaa
O55179_BCL2A1-01      tgctctttctcctcaagtaa
Q8K164_BCL2A1-01      tgctctttctcctcaagtaa
Q4FK02_BCL2A1-01      tgctctttctcctcaagtag
O55177_BCL2A1-02      tgctctttctcctcaagtaa
Q497M6_BCL2A1-01      tgctctttctcctcaagtaa
                                          

© 1998-2018