Dataset for CDS BCL-2 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P10417_BCL2-02      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacat
P10417_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacat
                    ************************************************************

P10417_BCL2-02      tataagctgtcacagaggggctacgagtgggatgctggagatgcggacgcggcgcccctg
P10417_BCL2-01      tataagctgtcacagaggggctacgagtgggatgctggagatgcggacgcggcgcccctg
                    ************************************************************

P10417_BCL2-02      ggggctgcccccacccctggcatcttctccttccagcctgagagcaacccaatgcccgct
P10417_BCL2-01      ggggctgcccccacccctggcatcttctccttccagcctgagagcaacccaatgcccgct
                    ************************************************************

P10417_BCL2-02      gtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
P10417_BCL2-01      gtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
                    ************************************************************

P10417_BCL2-02      cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgac
P10417_BCL2-01      cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgac
                    ************************************************************

P10417_BCL2-02      ttctctcgtcgctaccgtcgtgacttcgcagagatgtccagtcagctgcacctgacgccc
P10417_BCL2-01      ttctctcgtcgctaccgtcgtgacttcgcagagatgtccagtcagctgcacctgacgccc
                    ************************************************************

P10417_BCL2-02      ttcaccgcgaggggacgctttgccacggtggtggaggaactcttcagggatggggtgaac
P10417_BCL2-01      ttcaccgcgaggggacgctttgccacggtggtggaggaactcttcagggatggggtgaac
                    ************************************************************

P10417_BCL2-02      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
P10417_BCL2-01      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
                    ************************************************************

P10417_BCL2-02      agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccgg
P10417_BCL2-01      agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccgg
                    ************************************************************

P10417_BCL2-02      catctgcacacctggatccaggataacggaggctggg-----------------------
P10417_BCL2-01      catctgcacacctggatccaggataacggaggctgggatgcctttgtggaactatatggc
                    *************************************                       

P10417_BCL2-02      ------------------------------------------------------------
P10417_BCL2-01      cccagcatgcgacctctgtttgatttctcctggctgtctctgaagaccctgctcagcctg
                                                                                

P10417_BCL2-02      -------------------------taggtgcatgtctggt---tgaatga
P10417_BCL2-01      gccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
                                             * *******  ****      * ***

© 1998-2018