Dataset for CDS BCL-2-like of organism Monopterus albus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3K1K1_BCL2-01      atg---------------gcgaacgagtgtaatcgcaacgttgtggaaaa
A0A3Q3JQ78_BCL2L10      atg-----------tgcagagagc--------------------------
A0A3Q3IZW0_MCL1-01      atgaacatcattacctcgaagaagtgggcagacgttaacgttacaaccga
A0A3Q3IVF5_BCL2L1-      atg--tctcaaa---acaaagaactgg--------tggttttcta-----
A0A3Q3J5K3_BCL2L1-      atg--tcgtacagtcacagagagctgg--------tggagttcta-----
                        ***                 **                            

A0A3Q3K1K1_BCL2-01      gtacatctgccataaactctccaaacggggctacgtgtggggatttcatg
A0A3Q3JQ78_BCL2L10      --------accttgatatcgctggga-------------ggaa-------
A0A3Q3IZW0_MCL1-01      aatcatgagccttattcttcctcaaaatggagtcgtggaggga-------
A0A3Q3IVF5_BCL2L1-      ---cataacatataaactctcccaga--------------aaa-------
A0A3Q3J5K3_BCL2L1-      ---tataagctacaagttgtctcaga--------------gaa-------
                                         *  *                     *       

A0A3Q3K1K1_BCL2-01      atgtccaggatgaagatgctgctaataatgggtcaatagttgcccctcca
A0A3Q3JQ78_BCL2L10      --------------------aatgt-----------------cgtgtggg
A0A3Q3IZW0_MCL1-01      --------------------tccatgcactgcggctcaaatacctcacca
A0A3Q3IVF5_BCL2L1-      --------------------actat-----------------cctctcag
A0A3Q3J5K3_BCL2L1-      --------------------actactca-------------acctctctg
                                                                  *       

A0A3Q3K1K1_BCL2-01      ccgactttggttcgtcggtgccgtgaagccagcactgggcctgacagcga
A0A3Q3JQ78_BCL2L10      c----tgtggaaagacaccc---tggctctggcag-aggactacctg---
A0A3Q3IZW0_MCL1-01      cagtttgccgtaggatcttcaatagactcttgtaaaggcaatgttggg--
A0A3Q3IVF5_BCL2L1-      ccacttgggactaaa--------tgagtctccaaacaggactgatggaga
A0A3Q3J5K3_BCL2L1-      c----tgaggccgga--------aaacgctggtggaaggactgagggaga
                        *    *                      *        *   *    *   

A0A3Q3K1K1_BCL2-01      gagcaccccccacc-------------------------gctgcaagcgg
A0A3Q3JQ78_BCL2L10      -----------------------tctctgtgctgcacaagctcacggcca
A0A3Q3IZW0_MCL1-01      -------------cccaataatactctgaaacggcccaagatcctggatg
A0A3Q3IVF5_BCL2L1-      ggaggcaacgcacgccaatgggactttt-aacggcaccagtcccggga--
A0A3Q3J5K3_BCL2L1-      -------------------------------------------cagga--
                                                                      *   

A0A3Q3K1K1_BCL2-01      ccccctcagtc-----------------------------------cgac
A0A3Q3JQ78_BCL2L10      gcccctccacctcccagcg---------------------agtcagccgc
A0A3Q3IZW0_MCL1-01      tcagctcaacaaatgggtatggaacaaaaacccttgtggatgtcagcgac
A0A3Q3IVF5_BCL2L1-      cccccccagcatccccgc-taaggcaacaacagttgc---catcaacggc
A0A3Q3J5K3_BCL2L1-      ccaacccagc------------------------tac---cactaacggc
                         *  * *                                       *  *

A0A3Q3K1K1_BCL2-01      atgcacgc--------cgccattcacagagtcctgcgggag--gctggag
A0A3Q3JQ78_BCL2L10      ----------------tgccatgag--------------atgtctggccc
A0A3Q3IZW0_MCL1-01      attgacaacggctcattgccgtgta----gtcctgtgctacagccggata
A0A3Q3IVF5_BCL2L1-      a--aacctgga-----tgcggtgaaagaggccctccgggac--tcagcca
A0A3Q3J5K3_BCL2L1-      cttggcataga-----ggctgtaaaggctgctcttagggac--tctgctg
                                         **  *                 *      *   

A0A3Q3K1K1_BCL2-01      atgaacttgaa----agactataccag-----------------------
A0A3Q3JQ78_BCL2L10      aggacatggag----acgcagcaccagg----------------------
A0A3Q3IZW0_MCL1-01      atgaaattgaagtctccagttccccagcagagtacgaagtcctggagaat
A0A3Q3IVF5_BCL2L1-      atgagtttgag--ctgcgatatgcc-------------------------
A0A3Q3J5K3_BCL2L1-      atgagtttgaa--ctgcgcttcaca-------------------------
                        * **  * **             *                          

A0A3Q3K1K1_BCL2-01      --ccagacttcacagaaatgtcgcgcc--------------------agc
A0A3Q3JQ78_BCL2L10      --ctcgcttccactccctcgcgcagaccttcctga------------agc
A0A3Q3IZW0_MCL1-01      gacacgaggctactaatttgccacttccttagagattatactggactatc
A0A3Q3IVF5_BCL2L1-      --cgtgctttcagtgatctgcaccacc--------------------agc
A0A3Q3J5K3_BCL2L1-      --caagcatttagtgacctttcctcgc--------------------agc
                          *  *     *              *                    * *

A0A3Q3K1K1_BCL2-01      tccatctca------cctccaccacggcgcaga-----------------
A0A3Q3JQ78_BCL2L10      ag--tgtgggccggacccctgctccagtctc-------------------
A0A3Q3IZW0_MCL1-01      tacacatcggtggacccgcagaaaaactctatcgacgatgaaaagagttg
A0A3Q3IVF5_BCL2L1-      tgcatatca------caccagccacggcctacc-----------------
A0A3Q3J5K3_BCL2L1-      ttgtcatca------ctcctgacacagcctaca-----------------
                              *        *  *                               

A0A3Q3K1K1_BCL2-01      ---gaagattc------------------------gccgaggtgatagac
A0A3Q3JQ78_BCL2L10      -----------------------------------aggaaggtgatggaa
A0A3Q3IZW0_MCL1-01      tggagggcgttttggaaaaacacagatacgcatacaaaggcatgatcaac
A0A3Q3IVF5_BCL2L1-      ---aaagcttt------------------------gagagcgtgatggat
A0A3Q3J5K3_BCL2L1-      ---acagcttt------------------------aaaagcgtgatggat
                                                                  ****  * 

A0A3Q3K1K1_BCL2-01      gaactgttccgggacgg---------------------------------
A0A3Q3JQ78_BCL2L10      gagctggtgggagatggaca------------------------------
A0A3Q3IZW0_MCL1-01      aaactgtcactggacgagagaggggatgatatgagttttgtcggctcagt
A0A3Q3IVF5_BCL2L1-      gaagtgttccgggacgg---------------------------------
A0A3Q3J5K3_BCL2L1-      gaagtgttcaaagatgg---------------------------------
                         *  **      ** *                                  

A0A3Q3K1K1_BCL2-01      ---------------------------ggtgaactggggccggattatcg
A0A3Q3JQ78_BCL2L10      ---------------------------cttgaactgggggagggttgttt
A0A3Q3IZW0_MCL1-01      ggcccagagcatcttcgctgatgggaccaccaactgggggcggattacca
A0A3Q3IVF5_BCL2L1-      ---------------------------cgtcaactggggccgcatcatag
A0A3Q3J5K3_BCL2L1-      ---------------------------agtcaactggggacgtattgtgg
                                                       ********  *  *     

A0A3Q3K1K1_BCL2-01      cattcttcgagttcggcggcacgatgtgcgtggagtgcgctgccaaggag
A0A3Q3JQ78_BCL2L10      ccctattcgccttcaccggggtgctggctagacagctgacggagcagaat
A0A3Q3IZW0_MCL1-01      gccttttggcctttggtgcagtggtgtgt---cagtacctgaaggagaaa
A0A3Q3IVF5_BCL2L1-      ggctttttgcatttggcggggcgttgtgtgtcgagtgtgtggagaaagag
A0A3Q3J5K3_BCL2L1-      gcttgtttgcttttggtggtgcactgtgtgtggaatgcgtcgagaagaat
                           * ** *  **    *      **       *           *  * 

A0A3Q3K1K1_BCL2-01      gagatgacaccgcaagtggacaaga-------------------------
A0A3Q3JQ78_BCL2L10      ggcatgaagcccgggctggaccctgggcaggggcaggaactgggacaggg
A0A3Q3IZW0_MCL1-01      ggcagggagaactgtgtggagttgg-------------------------
A0A3Q3IVF5_BCL2L1-      atgagtccg--ctg-gtgggtagga-------------------------
A0A3Q3J5K3_BCL2L1-      atgagtgag--ctg-gtgtcccgca-------------------------
                           *            **                                

A0A3Q3K1K1_BCL2-01      --------------------tcgcggagtggatgacggagtatttaaatg
A0A3Q3JQ78_BCL2L10      gcccggaaactgcagggaactagcagagaccatagctgattacctgggag
A0A3Q3IZW0_MCL1-01      --------------------tgggacaggagatctccacgtacctgctgt
A0A3Q3IVF5_BCL2L1-      --------------------ttgtagagtggatgacagtctacctggata
A0A3Q3J5K3_BCL2L1-      --------------------tcgcagactggatgaccatgtacctggatg
                                            * *   *    **  *    **  *     

A0A3Q3K1K1_BCL2-01      gacctctaaacagctggattcaag----aaaacgggggatgggatgcctt
A0A3Q3JQ78_BCL2L10      aggagaagaaagactggct----gctggaaaacgatggatgggaggggtt
A0A3Q3IZW0_MCL1-01      ctcaccagcgggactggct----ggttaagaacaacgcttgggacggctt
A0A3Q3IVF5_BCL2L1-      accacattcagccctggatccaaggccaagga----ggatgggagcgctt
A0A3Q3J5K3_BCL2L1-      agcacatcagtccgtggatccagaaccaagga----ggctgggactgctt
                                      *** *         *  *    *  *****    **

A0A3Q3K1K1_BCL2-01      tgtggagctgtatgacaga----------cagagg----gagtcggtctt
A0A3Q3JQ78_BCL2L10      ctgtaagttctcc--------cgcagcgccagaga----ggtgag----c
A0A3Q3IZW0_MCL1-01      tgaagaatttttt---cgagtagcagacccagagtctacagtgaggacca
A0A3Q3IVF5_BCL2L1-      tgctgaactctttgggcaggatgcggcggcagaga----acaggaggtct
A0A3Q3J5K3_BCL2L1-      tgcagagatttttgggcgagataacgctgcagaag----tgcgaagatct
                             *  * *                  ****                 

A0A3Q3K1K1_BCL2-01      ca---gttgctcttg-------gccttccatcaagacagtttttggtctg
A0A3Q3JQ78_BCL2L10      catgactcgtccgtgaagacggcgctgttcgctg-------------ctg
A0A3Q3IZW0_MCL1-01      cacttatggcctttgctggatttgctggtatcggggcaactctggccctg
A0A3Q3IVF5_BCL2L1-      ca---ggagagcttcaagaagtggctgctggcgggg-----atgaccctg
A0A3Q3J5K3_BCL2L1-      ca---ggagaccctgaggagatggctgctagttgga-----gtggtgctg
                        **      *    *          **                     ***

A0A3Q3K1K1_BCL2-01      gctgcacttggagcagctagccttactattggagctta------------
A0A3Q3JQ78_BCL2L10      ctggcg---tggg----------cctcgctgg-actca------------
A0A3Q3IZW0_MCL1-01      ttgatc---aggacaaacaacacttgtggagg-ccttaagaggaaatgga
A0A3Q3IVF5_BCL2L1-      gtgacc---ggcg----------tcgtggtgg-gctca------------
A0A3Q3J5K3_BCL2L1-      ctaaca---ggag----------tgctggttg-gtgtg------------
                                  *                    *                  

A0A3Q3K1K1_BCL2-01      -------ccttacac--agaaa----------------------------
A0A3Q3JQ78_BCL2L10      -------ccttcctcctggaaacaagtgggacatgtgagcgggaacagtt
A0A3Q3IZW0_MCL1-01      gtagagcctctcca-----------tgg----------------------
A0A3Q3IVF5_BCL2L1-      -------ctcatcatccagaaacgcctg----------------------
A0A3Q3J5K3_BCL2L1-      -------cttgtcgctaagaaa---ttg----------------------
                               *    *                                     

A0A3Q3K1K1_BCL2-01      -------------tga
A0A3Q3JQ78_BCL2L10      caggaagtctgactga
A0A3Q3IZW0_MCL1-01      -------------tga
A0A3Q3IVF5_BCL2L1-      -------------tga
A0A3Q3J5K3_BCL2L1-      -------------tga
                                     ***

© 1998-2019