Dataset for CDS BCL2L1 of organism Monopterus albus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3IVF5_BCL2L1-      atgtctcaaa---acaaagaactggtggttttctacataacatataaact
A0A3Q3J5K3_BCL2L1-      atgtcgtacagtcacagagagctggtggagttctatataagctacaagtt
                        *****  * *   *** *** *******  ***** ****  ** **  *

A0A3Q3IVF5_BCL2L1-      ctcccagaaaaactat----cctctcagccacttgggactaaatgagtct
A0A3Q3J5K3_BCL2L1-      gtctcagagaaactactcaacctctctgc----tgaggccggaaaacgct
                         ** **** ******     ****** **    ** * *   *  *  **

A0A3Q3IVF5_BCL2L1-      ccaaacaggactgatggagaggaggcaacgcacgccaatgggacttttaa
A0A3Q3J5K3_BCL2L1-      ggtggaaggactgagggaga------------------------------
                              ******** *****                              

A0A3Q3IVF5_BCL2L1-      cggcaccagtcccgggacccccccagcatccccgctaaggcaacaacagt
A0A3Q3J5K3_BCL2L1-      ------------caggaccaacccagc-----------------------
                                    * *****  ******                       

A0A3Q3IVF5_BCL2L1-      tgccatcaacggca--aacctggatgcggtgaaagaggccctccgggact
A0A3Q3J5K3_BCL2L1-      taccactaacggccttggcatagaggctgtaaaggctgctcttagggact
                        * ***  ******     * * ** ** ** ** *  ** **  ******

A0A3Q3IVF5_BCL2L1-      cagccaatgagtttgagctgcgatatgcccgtgctttcagtgatctgcac
A0A3Q3J5K3_BCL2L1-      ctgctgatgagtttgaactgcgcttcacacaagcatttagtgacctttcc
                        * **  ********** ***** *   * *  ** ** ***** **   *

A0A3Q3IVF5_BCL2L1-      caccagctgcatatcacaccagccacggcctaccaaagctttgagagcgt
A0A3Q3J5K3_BCL2L1-      tcgcagcttgtcatcactcctgacacagcctacaacagctttaaaagcgt
                           *****    ***** ** * *** ****** * ****** * *****

A0A3Q3IVF5_BCL2L1-      gatggatgaagtgttccgggacggcgtcaactggggccgcatcatagggc
A0A3Q3J5K3_BCL2L1-      gatggatgaagtgttcaaagatggagtcaactggggacgtattgtgggct
                        ****************   ** ** *********** ** **  * **  

A0A3Q3IVF5_BCL2L1-      tttttgcatttggcggggcgttgtgtgtcgagtgtgtggagaaagagatg
A0A3Q3J5K3_BCL2L1-      tgtttgcttttggtggtgcactgtgtgtggaatgcgtcgagaagaatatg
                        * ***** ***** ** **  ******* ** ** ** *****  * ***

A0A3Q3IVF5_BCL2L1-      agtccgctggtgggtaggattgtagagtggatgacagtctacctggataa
A0A3Q3J5K3_BCL2L1-      agtgagctggtgtcccgcatcgcagactggatgaccatgtacctggatga
                        ***  *******    * ** * *** ********  * ********* *

A0A3Q3IVF5_BCL2L1-      ccacattcagccctggatccaaggccaaggaggatgggagcgctttgctg
A0A3Q3J5K3_BCL2L1-      gcacatcagtccgtggatccagaaccaaggaggctgggactgctttgcag
                         *****    ** ********   ********* *****  ******* *

A0A3Q3IVF5_BCL2L1-      aactctttgggcaggatgcggcggcagagaacaggaggtctcaggagagc
A0A3Q3J5K3_BCL2L1-      agatttttgggcgagataacgctgcagaagtgcgaagatctcaggagacc
                        *  * *******  ***   ** *****     * ** ********** *

A0A3Q3IVF5_BCL2L1-      ttcaagaagtggctgctggcggggatgaccctggtgaccggcgtcgtggt
A0A3Q3J5K3_BCL2L1-      ctgaggagatggctgctagttggagtggtgctgctaacaggagtgctggt
                         * * **  ******** *  **  **   *** * ** ** **  ****

A0A3Q3IVF5_BCL2L1-      gggctcactcatcatccagaaacgcctgtga
A0A3Q3J5K3_BCL2L1-      tggtgtgcttgtcgctaagaaa---ttgtga
                         **    **  **    *****    *****

© 1998-2019