Dataset for CDS BCL-2-like of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6SFL4_BCL2A1-01       atggatgat------------------tacgag-----------------
F6YNL8_BCL2-01         atgatggctcaccctggaagaagaggatatgataaccgggagatagtgat
F6WA14_BCL2L1-01       atgtcg---------------------cacagtaaccgggagctggtgat
F6VJQ0_BCL2L10-01      atggat---------------------tacaag-----------------
F6U940_BCL2L2-01       --------------------------------------------------
F6ZMX1_MCL1-01         atg-----------------------------t-----------------
                                                                         

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         gaaatacattcattataaactgtcacagagggggtacgagtgggatgctg
F6WA14_BCL2L1-01       tgactttctttcttacaagctctcacagaaagga----------------
F6VJQ0_BCL2L10-01      ---------------tgtgctcttagggaagaga----------------
F6U940_BCL2L2-01       ---------------------------------a----------------
F6ZMX1_MCL1-01         ---------------taggccctttcaagaagaa----------------
                                                                         

F6SFL4_BCL2A1-01       ------ttccattatgttcacatgttagctc-------------------
F6YNL8_BCL2-01         gagatctgagggcaccagcctctccaagtcttcctcctgttgttgcttct
F6WA14_BCL2L1-01       ------tacaattggagtcagtttgaagatg-------------------
F6VJQ0_BCL2L10-01      ------cggcgcggctggtaactgactacct-------------------
F6U940_BCL2L2-01       ------tggcgactccagc--ct--cagccc-------------------
F6ZMX1_MCL1-01         ------cgccgtcatcggc--ct--caacct-------------------
                                             *                           

F6SFL4_BCL2A1-01       ----------------------------------gggact----------
F6YNL8_BCL2-01         gcccctgctgttggaatcttctctacccagccacgaaacacaccattgcc
F6WA14_BCL2L1-01       ----------------------------------agaaca---------g
F6VJQ0_BCL2L10-01      ----------------------------------ggaata---------t
F6U940_BCL2L2-01       ----------------------------------cagata---------c
F6ZMX1_MCL1-01         ----------------------------------t---ta---------c
                                                                         

F6SFL4_BCL2A1-01       ----------------------------acttgaagcatgttcaacagac
F6YNL8_BCL2-01         tgctgaaccccaggactcggccacttctactactgctgctgctagaaact
F6WA14_BCL2L1-01       gactgaggttctagaaggggcagagatacctagtactgtgaatggcagtc
F6VJQ0_BCL2L10-01      tgttgccgg--agggaaggcg-------tccaggagc------tgccggc
F6U940_BCL2L2-01       t---------------cgagc-------cctggtggcagattttgtgggt
F6ZMX1_MCL1-01         tgtggcggggcagggatgggc-------gccggcggcggcgccagcggtc
                                                    *                    

F6SFL4_BCL2A1-01       acc--------------------------------accactgggatcatg
F6YNL8_BCL2-01         cacctttgcctcttcctcctcctgctgttgctgctgctgctgctgctgga
F6WA14_BCL2L1-01       cctcttggcacc-----ctgctgacagccgtg-ctgtgagtgg-------
F6VJQ0_BCL2L10-01      ccc-----tacc-----cctgctgcagctaca-ctgcgtttggt------
F6U940_BCL2L2-01       tac-----aagc-----tgaggcagaagggct-atgcctgtggaactggc
F6ZMX1_MCL1-01         ccc-----cgtc-----cggcgggcgcctgct-a-gcttctggcaaaggc
                                                               **        

F6SFL4_BCL2A1-01       tcta-----aataagacatctcaaatactacaaaaggttgctttctctgt
F6YNL8_BCL2-01         cctaccgtcagtccagtgccacctgtggtccacctgactcttcgtcaa--
F6WA14_BCL2L1-01       ------ggccacagggcacagca-gcagcctggatgcccatgagacaata
F6VJQ0_BCL2L10-01      ------gtcgagcgagctccgcc-agat----------------------
F6U940_BCL2L2-01       ccag-----gagagggccctaca-acagagcccttgc-------------
F6ZMX1_MCL1-01         cctacggttgagagtactccgcc-gcagcgcgatggaggggaagtggaaa
                                            *                            

F6SFL4_BCL2A1-01       ccaacaagaagtagaaaaggata--------------------tggaaac
F6YNL8_BCL2-01         --------------------------gctg-------------gag----
F6WA14_BCL2L1-01       ccag-----------------tggctgctgtgaagcaagctttgagggag
F6VJQ0_BCL2L10-01      ------------------------ttacca-------------g------
F6U940_BCL2L2-01       --------accgggccatgcgtg-ctgctg-------------gag----
F6ZMX1_MCL1-01         cagggacggcgggggcagggttgattggcg-------------gaggaat
                                                                         

F6SFL4_BCL2A1-01       atgcttgagcactttggacatcgtttc-----------------------
F6YNL8_BCL2-01         ----atgatttctctagaa---ggtac----------------------c
F6WA14_BCL2L1-01       gcaggagatgaatttgaacttcggtac----------------------a
F6VJQ0_BCL2L10-01      ------gacttcttcgagt-----------------------------gc
F6U940_BCL2L2-01       ----acgag---tttgagtcccgcttt----------------------c
F6ZMX1_MCL1-01         ccgtgcgagtcctccgaatcctgtctcgccgggcgcccggggggtcgcgc
                             **    *                                     

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         ggagagactttgatgaaatgt------------------caggtcaactg
F6WA14_BCL2L1-01       ggcgggcattcagtgacctga------------------catcccagctc
F6VJQ0_BCL2L10-01      gccctgaatcagctac-----------------------tcgaccgggaa
F6U940_BCL2L2-01       gacgcacattttctgatctgg------------------ccgctcagttg
F6ZMX1_MCL1-01         ggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatg
                                                                         

F6SFL4_BCL2A1-01       ----------------tgtagagtctgccagaagaattttcaatagtgtt
F6YNL8_BCL2-01         cacctgac--------ccctgttactgctaggggacgctttgccacagtg
F6WA14_BCL2L1-01       cacatcacg-------ccaggaa-cagcttatcagagctttgagcaggta
F6VJQ0_BCL2L10-01      c---------------ctgagcaagtaatcgtcaacg--tagcggagctc
F6U940_BCL2L2-01       catgtgact-------cctggct-cggctcagcagcgctttacccaggtc
F6ZMX1_MCL1-01         c-cgagcctgttcgcgccgggccgctgctcgtcggcgc-ccgccgaggtg
                                           *                           * 

F6SFL4_BCL2A1-01       atgaag--------------------------------------------
F6YNL8_BCL2-01         gtagag--------------------------------------------
F6WA14_BCL2L1-01       gtgaat--------------------------------------------
F6VJQ0_BCL2L10-01      atgga---------------------------------------------
F6U940_BCL2L2-01       tcagat--------------------------------------------
F6ZMX1_MCL1-01         gccgatggggctgcggacgtcccaatgtgccctgaggaggaactggacgg
                           *                                             

F6SFL4_BCL2A1-01       ----------aaggaatttgaggatggcgtcatt----------------
F6YNL8_BCL2-01         ----------gagctgttcagggatggggtg-------------------
F6WA14_BCL2L1-01       ----------gaactcttccgggatggggtg-------------------
F6VJQ0_BCL2L10-01      ------------------ccgaggcgagttc-------------------
F6U940_BCL2L2-01       ----------gagctcttccaaggggggccc-------------------
F6ZMX1_MCL1-01         ttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctgg
                                                                         

F6SFL4_BCL2A1-01       -------------aactggggacggattgtcaccatatttgcttttgggg
F6YNL8_BCL2-01         -------------aactgggggaggatcgtggccttctttgagtttggtg
F6WA14_BCL2L1-01       -------------aactggggccgaattgtggcattcttctccttcggag
F6VJQ0_BCL2L10-01      -------------aactggggccgggtggcggtgctagtggtttttgccg
F6U940_BCL2L2-01       -------------aactggggccgtcttgtggcattcttcgtctttgggg
F6ZMX1_MCL1-01         aaatagcccgggaaggtggggacagcccgaacggctctttgccttcgacg
                                    *  *****       *      *  *    ** *  *

F6SFL4_BCL2A1-01       gaattct-------------catcaagaagcttctgagacatagagctcc
F6YNL8_BCL2-01         gtgttat-gtgtgtggagagcgtcaaccgg-----gagatgt--------
F6WA14_BCL2L1-01       gggcatt-gtgtgtggaaagcgtggataag-----gagatgg--------
F6VJQ0_BCL2L10-01      gggcgctgctggagatggaggaactactga-----aagagga--------
F6U940_BCL2L2-01       cagcgct-ctgtgcagagagtgtcaacaaa-----gagatgg--------
F6ZMX1_MCL1-01         ccgcccc-cagctgag-gaggatgaagaag-----aggatgaactatacg
                                                *           **           

F6SFL4_BCL2A1-01       actgactatgggcactcag----------------gaagaaatttctcat
F6YNL8_BCL2-01         ---cgcccctggtg---------------------gacagcattgcccta
F6WA14_BCL2L1-01       ---aagtcttggta---------------------ggacgcatcacctcc
F6VJQ0_BCL2L10-01      -gcaggtactgcagcttc----------------------ggagggaaac
F6U940_BCL2L2-01       ---agccactggtg---------------------ggacaggtgcaggac
F6ZMX1_MCL1-01         ggcagtccttggagctcatcagccggtaccttcgcgagcaggcggttggc
                                 *                                       

F6SFL4_BCL2A1-01       tttattgccgagtt---------------------cataatgaacaata-
F6YNL8_BCL2-01         tggatgactgagta---------------------cctgaaccggcacc-
F6WA14_BCL2L1-01       tggatggccactta---------------------cttggatgaccacc-
F6VJQ0_BCL2L10-01      gagccggcgtctga---------------------ccgaaaaactctgca
F6U940_BCL2L2-01       tggatggtgaccta---------------------cctagagacacagc-
F6ZMX1_MCL1-01         acgaaggaggccaagcccctacgcagcggcaaggccttagagaccctgcg
                                                          *              

F6SFL4_BCL2A1-01       -----tagcagagtggataagacaaa-----atggaggat----------
F6YNL8_BCL2-01         -----tgcacacttggatccaggata-----acggaggat----------
F6WA14_BCL2L1-01       -----tagacccttggatccaagaaa-----atggcggct----------
F6VJQ0_BCL2L10-01      ac-------------tatctggtgga------------------------
F6U940_BCL2L2-01       -----tggcagactggatccacagca-----gtgggggct----------
F6ZMX1_MCL1-01         acgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggca
                                        *       *                        

F6SFL4_BCL2A1-01       ---------------------------gggaaa-----atggctttgtaa
F6YNL8_BCL2-01         ---------------------------gggatgcctttgtggaattgtat
F6WA14_BCL2L1-01       ---------------------------gggacacctttgtggaactttat
F6VJQ0_BCL2L10-01      --------------------------gaggaagggcgcgtggctgcatg-
F6U940_BCL2L2-01       ---------------------------gggcggaattcacggctctgtac
F6ZMX1_MCL1-01         tgcttcggaaattggatatcaaaaacgaagaggatattaaagctgtgtct
                                                    *           *     *  

F6SFL4_BCL2A1-01       ag-----aactttgaac----------------ctaatacagtgtggccg
F6YNL8_BCL2-01         ggcaacagcatgaggcc---------------------------------
F6WA14_BCL2L1-01       gg-----gaatgatgca---------------gctgcagagagccggaag
F6VJQ0_BCL2L10-01      ag-----aacggaggct-----------------------ggactgg---
F6U940_BCL2L2-01       gg-----ggatggggcc--------------------------ctggagg
F6ZMX1_MCL1-01         cg-----agtggcgacccatgttttcagtgacggtataacaaactggggc
                        *                                                

F6SFL4_BCL2A1-01       aac------------------ttcacagatatttcaacaaag--------
F6YNL8_BCL2-01         ---------tttgttcgatttctcctggctgtctctgaagactcttctca
F6WA14_BCL2L1-01       ggc--------------------caggaacgcttcaaccgatggct----
F6VJQ0_BCL2L10-01      -------------------ctttcaccaccacttcgaaaaa---------
F6U940_BCL2L2-01       agg--------------------caaggcgtctgcgggaggggaact---
F6ZMX1_MCL1-01         aggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaa
                                              *                          

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         g-----------------------------cctggct-------------
F6WA14_BCL2L1-01       ------------------------------gctgactggcatgacagt--
F6VJQ0_BCL2L10-01      ------------aggcaatctcctccaccaagtgactcaagtaataatac
F6U940_BCL2L2-01       gggcctcagtgcgaacagt-----------gctaacaggggctgtagcac
F6ZMX1_MCL1-01         gagcataaaccaggaaagttgcatagacccgctagcagaaagcataaca-
                                                                         

F6SFL4_BCL2A1-01       -----------------------------------------------atc
F6YNL8_BCL2-01         -------------------------------------------------c
F6WA14_BCL2L1-01       -----------------------------------------------ggc
F6VJQ0_BCL2L10-01      actgtgct---------gcataatggcagc---------agcagcaggat
F6U940_BCL2L2-01       tgggggctctggt----------------------------------gac
F6ZMX1_MCL1-01         --gatgttctggtcaagacaaaacgggactggctgattaagcaaaagggc
                                                                         

F6SFL4_BCL2A1-01       tggggcatattt--------------------------------------
F6YNL8_BCL2-01         tggtgggagcttgtgtcactcttggt------------------------
F6WA14_BCL2L1-01       cggtgtagtcctgctggggtcccta-------------------------
F6VJQ0_BCL2L10-01      t----tggactagtgggattagctc-------------------------
F6U940_BCL2L2-01       tgtgggggcctt--------------------------------------
F6ZMX1_MCL1-01         tgggagggatttgtggaattctttcatgtacaggacctagaaggtggcat
                                                                         

F6SFL4_BCL2A1-01       ------------------tcctttctg-----------------------
F6YNL8_BCL2-01         ------------------gcctacctgggacac-----------------
F6WA14_BCL2L1-01       ------------------ttcagccgg-----------------------
F6VJQ0_BCL2L10-01      ------------------ttttattagt----------------------
F6U940_BCL2L2-01       ------------------ctttgccagc----------------------
F6ZMX1_MCL1-01         cagaaatgtgctgctcgcctttgccggtgttgctggagtaggagctggtt
                                                 *                       

F6SFL4_BCL2A1-01       --------------aagtaa
F6YNL8_BCL2-01         --------------aaatga
F6WA14_BCL2L1-01       --------------aagtga
F6VJQ0_BCL2L10-01      ----------cgtacgataa
F6U940_BCL2L2-01       --------------aagtga
F6ZMX1_MCL1-01         tggcatatctaataagatag
                                        *  

© 1998-2018